MCCC1 (NM_020166) Human 3' UTR Clone

CAT#: SC202837

3`UTR clone of methylcrotonoyl-Coenzyme A carboxylase 1 (alpha) (MCCC1) nuclear gene encoding mitochondrial protein for miRNA target validation


Reconstitution Protocol

USD 560.00

4 Weeks*

Size
    • 10 ug

Product Images

Other products for "MCCC1"

Specifications

Product Data
Vector pMirTarget
Species Human
Transfection Reporter RFP
Assay Reporter Luciferase
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Symbol MCCC1
Synonyms MCC-B; MCCA
ACCN NM_020166
Insert Size 245
Sequence Data
>SC202837 3'UTR clone of NM_020166
The sequence shown below is from the reference sequence of NM_020166. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon


CAATTGGCAGAGCTCAGAATTCAAGCGATCGC

GTCGAGTTTGAGGAGGAAGAATCAGACAAAAGGGAATCGGAATAAACTCCAGCAAGGAAATGGCCAGTTA
AGTAGTGTCTTCTCTCTCCACCAAAAAGAGGAAGTGCCTCCAGCTTTTCTGGGGGTCTCATAAAGAGCAG
TTTTACTAAATGATTGTATGCTTATGCTGAACACCTTTCATATTGGAGAATCATGCATTTGGGTCACTAA
TTATCTCAAAATATTTCATACTAATAAAGTTGAAT

ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Reference Data
RefSeq NM_020166.3
Summary This gene encodes the large subunit of 3-methylcrotonyl-CoA carboxylase. This enzyme functions as a heterodimer and catalyzes the carboxylation of 3-methylcrotonyl-CoA to form 3-methylglutaconyl-CoA. Mutations in this gene are associated with 3-Methylcrotonylglycinuria, an autosomal recessive disorder of leucine catabolism. [provided by RefSeq, Jul 2008]
Locus ID 56922

Documents

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.