C2orf40 (NM_032411) Human 3' UTR Clone

CAT#: SC202869

3`UTR clone of chromosome 2 open reading frame 40 (C2orf40) for miRNA target validation

Specifications

Product Data

• Vector: pMirTarget
• Species: Human
• Transfection Reporter: RFP
• Assay Reporter: Luciferase
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Symbol: C2orf40
• Synonyms: ECRG4
• ACCN: NM_032411
• Insert Size: 271
• Sequence Data:
  Insert Sequence

  >SC202869 3'UTR clone of NM_032411
  The sequence shown below is from the reference sequence of NM_032411. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon
  
  
  CAATTGGCAGAGCTCAGAATTCAAGCGATCGC
  
  CTACGGCTTTAGGCATGGAGCCAGCGTCAACTACGATGACTACTAACCATGACTTGCCACACGCTGTACA
  AGAAGCAAATAGCGATTCTCTTCATGTATCTCCTAATGCCTTACACTACTTGGTTTCTGATTTGCTCTAT
  TTCAGCAGATCTTTTCTACCTACTTTGTGTGATCAAAAAAGAAGAGTTAAAACAACACATGTAAATGCCT
  TTTGATATTTCATGGGAATGCCTCTCATTTAAAAATAGAAATAAAGCATTTTGTTAAAAAG
  
  ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
• Restriction Sites: SgfI-MluI
• OTI Disclaimer: Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).

Reference Data

• RefSeq: NM_032411.2
• Summary: Probable hormone that may induce senescence of oligodendrocyte and neural precursor cells, characterized by G1 arrest, RB1 dephosphorylation and accelerated CCND1 and CCND3 proteasomal degradation. [UniProtKB/Swiss-Prot Function]
• Locus ID: 84417