MATK (NM_139354) Human 3' UTR Clone

CAT#: SC202882

3`UTR clone of megakaryocyte-associated tyrosine kinase (MATK) transcript variant 3 for miRNA target validation

Specifications

Product Data

• Vector: pMirTarget
• Species: Human
• Transfection Reporter: RFP
• Assay Reporter: Luciferase
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Symbol: MATK
• Synonyms: CHK; CTK; HHYLTK; HYL; HYLTK; Lsk
• ACCN: NM_139354
• Insert Size: 201 bp
• Sequence Data:
  Insert Sequence

  >SC202882 3'UTR clone of NM_139354
  The sequence shown below is from the reference sequence of NM_139354. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon
  
  
  CAATTGGCAGAGCTCAGAATTCAAGCGATCGC
  
  CCGAAGCCAGGAGCCCTGACCCCACCCGGTGGGGCCCTTGGCCCCAGAGGACCGAGAGAGTGGAGAGTGC
  GGCGTGGGGGCACTGACCAGGCCCAAGGAGGGTCCAGGCGGGCAAGTCATCCTCCTGGTGCCCACAGCAG
  GGGCTGGCCCACGTAGGGGGCTCTGGGCGGCCCGTGGACACCCCAGACCTGCGAAGGATGA
  
  ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
• Restriction Sites: SgfI-MluI
• OTI Disclaimer: Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
• Product Components: The cDNA clone is shipped in a 2-D bar-coded Matrix tube as 10 ug dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.

Reference Data

• RefSeq: NM_139354.2
• Summary: 'The protein encoded by this gene has amino acid sequence similarity to Csk tyrosine kinase and has the structural features of the CSK subfamily: SRC homology SH2 and SH3 domains, a catalytic domain, a unique N terminus, lack of myristylation signals, lack of a negative regulatory phosphorylation site, and lack of an autophosphorylation site. This protein is thought to play a significant role in the signal transduction of hematopoietic cells. It is able to phosphorylate and inactivate Src family kinases, and may play an inhibitory role in the control of T-cell proliferation. This protein might be involved in signaling in some cases of breast cancer. Three alternatively spliced transcript variants that encode different isoforms have been described for this gene. [provided by RefSeq, Jul 2008]'
• Locus ID: 4145