SUCLG1 (NM_003849) Human 3' UTR Clone

CAT#: SC202931

3`UTR clone of succinate-CoA ligase alpha subunit (SUCLG1) for miRNA target validation

Specifications

Product Data

• Vector: pMirTarget
• Species: Human
• Transfection Reporter: RFP
• Assay Reporter: Luciferase
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Symbol: SUCLG1
• Synonyms: GALPHA; MTDPS9; SUCLA1
• ACCN: NM_003849
• Insert Size: 247
• Sequence Data:
  Insert Sequence

  >SC202931 3'UTR clone of NM_003849
  The sequence shown below is from the reference sequence of NM_003849. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon
  
  
  CAATTGGCAGAGCTCAGAATTCAAGCGATCGC
  
  GGAACCACGATCTACAAGGAATTTGAAAAGAGGAAGATGCTATGAAAGAAAAAAAAAATTCCTAAAACTG
  TGGAATGGATCACGTAGACATGTAACCCAGCAGCAGTTTGCTTCTGTTGTCCACTGATTAATCAGCCTAT
  GTGCCTGACACTGGTCTTGCAGTACAACTGGAAGCCAAAACAAGGTGGAAGATGTCCTGAATTAAGATGT
  TTTCACCACATTGTATTACAGAGACAGCCAATAAATC
  
  ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
• Restriction Sites: SgfI-MluI
• OTI Disclaimer: Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).

Reference Data

• RefSeq: NM_003849.3
• Summary: This gene encodes the alpha subunit of the heterodimeric enzyme succinate coenzyme A ligase. This enzyme is targeted to the mitochondria and catalyzes the conversion of succinyl CoA and ADP or GDP to succinate and ATP or GTP. Mutations in this gene are the cause of the metabolic disorder fatal infantile lactic acidosis and mitochondrial DNA depletion. [provided by RefSeq, Feb 2010]
• Locus ID: 8802