U1A (SNRPA) (NM_004596) Human 3' UTR Clone

CAT#: SC202944

3`UTR clone of small nuclear ribonucleoprotein polypeptide A (SNRPA) for miRNA target validation

Specifications

Product Data

• Vector: pMirTarget
• Species: Human
• Transfection Reporter: RFP
• Assay Reporter: Luciferase
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Symbol: SNRPA
• Synonyms: Mud1; U1-A; U1A
• ACCN: NM_004596
• Insert Size: 258 bp
• Sequence Data:
  Insert Sequence

  >SC202944 3'UTR clone of NM_004596
  The sequence shown below is from the reference sequence of NM_004596. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon
  
  
  CAATTGGCAGAGCTCAGAATTCAAGCGATCGC
  
  ATCACGCAGAACAACGCCATGAAGATCTCCTTTGCCAAGAAGTAGCACCTTTTCCCCCCATGCCTGCCCC
  TTCCCCTGTTCTGGGGCCACCCCTTTCCCCCTTGGCTCAGCCCCCTGAAGGTAAGTCCCCCCTTGGGGGC
  CTTCTTGGAGCCGTGTGTGAGTGAGTGGTCGCCACACAGCATTGTACCCAGAGTCTGTCCCCAGACATTG
  CACCTGGCGCTGTTAGGCCGGAATTAAAGTGGCTTTTTGAGGTTTGGT
  
  ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
• Restriction Sites: SgfI-MluI
• OTI Disclaimer: Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
• Product Components: The cDNA clone is shipped in a 2-D bar-coded Matrix tube as 10 ug dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.

Reference Data

• RefSeq: NM_004596.3
• Summary: 'The protein encoded by this gene associates with stem loop II of the U1 small nuclear ribonucleoprotein, which binds the 5' splice site of precursor mRNAs and is required for splicing. The encoded protein autoregulates itself by polyadenylation inhibition of its own pre-mRNA via dimerization and has been implicated in the coupling of splicing and polyadenylation. [provided by RefSeq, Oct 2010]'
• Locus ID: 6626