GPR65 (NM_003608) Human 3' UTR Clone

CAT#: SC202958

3`UTR clone of G protein-coupled receptor 65 (GPR65) for miRNA target validation

Specifications

Product Data

• Vector: pMirTarget
• Species: Human
• Transfection Reporter: RFP
• Assay Reporter: Luciferase
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Symbol: GPR65
• Synonyms: hTDAG8; TDAG8
• ACCN: NM_003608
• Insert Size: 201
• Sequence Data:
  Insert Sequence

  >SC202958 3'UTR clone of NM_003608
  The sequence shown below is from the reference sequence of NM_003608. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon
  
  
  CAATTGGCAGAGCTCAGAATTCAAGCGATCGC
  
  GGAATTAGAGGTCCTTGAGTAGAACCAAGGATGTTTTGAAGGGAAGGGAAGTTTAAGTTATGCATTATTA
  TATCATCAAGATTACATTTTGAAAAGGAAATCTAGCATGTGAGGGGACTAAGTGTTCTCAGAGTGATGTT
  TTAATCCAGTCCAATAAAAATATCTTAAAACTGCATTGTACAGCTCCCTCCCTGCGTTTTA
  
  ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
• Restriction Sites: SgfI-MluI
• OTI Disclaimer: Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).

Reference Data

• RefSeq: NM_003608.2
• Locus ID: 8477