ELOC (NM_005648) Human 3' UTR Clone

CAT#: SC202987

3`UTR clone of transcription elongation factor B (SIII) polypeptide 1 (15kDa elongin C) (TCEB1) for miRNA target validation

Specifications

Product Data

• Vector: pMirTarget
• Species: Human
• Transfection Reporter: RFP
• Assay Reporter: Luciferase
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Symbol: ELOC
• Synonyms: SIII; TCEB1
• ACCN: NM_005648
• Insert Size: 251 bp
• Sequence Data:
  Insert Sequence

  >SC202987 3'UTR clone of NM_005648
  The sequence shown below is from the reference sequence of NM_005648. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon
  
  
  CAATTGGCAGAGCTCAGAATTCAAGCGATCGC
  
  ACTGGAACTGCTGATGGCTGCGAACTTCTTAGATTGTTAAATAAAATAAATTATAATAAACTGTTAACTC
  TTTTCAGTATTTAATACCTGTAGTTCAGTTAGTAACTTTTTCATATATAGCATGTTGCCTGTATGCAGTT
  GAACTATATAAAGTTCATTGCAAAGCAGATTATCTTGTTTTTTTGCATAGCAATCAAAGTTGAAATTTGT
  TTGCTACATCAACAAATTAAGGACATTTTCACAAACTGAGA
  
  ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
• Restriction Sites: SgfI-MluI
• OTI Disclaimer: Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
• Product Components: The cDNA clone is shipped in a 2-D bar-coded Matrix tube as 10 ug dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.

Reference Data

• RefSeq: NM_005648.2
• Summary: 'This gene encodes the protein elongin C, which is a subunit of the transcription factor B (SIII) complex. The SIII complex is composed of elongins A/A2, B and C. It activates elongation by RNA polymerase II by suppressing transient pausing of the polymerase at many sites within transcription units. Elongin A functions as the transcriptionally active component of the SIII complex, whereas elongins B and C are regulatory subunits. Elongin A2 is specifically expressed in the testis, and capable of forming a stable complex with elongins B and C. The von Hippel-Lindau tumor suppressor protein binds to elongins B and C, and thereby inhibits transcription elongation. Multiple alternatively spliced transcript variants encoding two distinct isoforms have been identified. [provided by RefSeq, Mar 2011]'
• Locus ID: 6921