NM23A (NME1) (NM_198175) Human 3' UTR Clone

CAT#: SC202994

3`UTR clone of non-metastatic cells 1 protein (NM23A) expressed in (NME1) transcript variant 1 for miRNA target validation

Specifications

Product Data

• Vector: pMirTarget
• Species: Human
• Transfection Reporter: RFP
• Assay Reporter: Luciferase
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Symbol: NME1
• Synonyms: AWD; GAAD; NB; NBS; NDKA; NDPK-A; NDPKA; NM23; NM23-H1
• ACCN: NM_198175
• Insert Size: 254 bp
• Sequence Data:
  Insert Sequence

  >SC202994 3'UTR clone of NM_198175
  The sequence shown below is from the reference sequence of NM_198175. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon
  
  
  CAATTGGCAGAGCTCAGAATTCAAGCGATCGC
  
  GCTGTGCTCAGAACTGGATCTATGAATGACAGGAGGGCAGACCACATTGCTTTTCACATCCATTTCCCCT
  CCTTCCCATGGGCAGAGGACCAGGCTGTAGGAAATCTAGTTATTTACAGGAACTTCATCATAATTTGGAG
  GGAAGCTCTTGGAGCTGTGAGTTCTCCCTGTACAGTGTTACCATCCCCGACCATCTGATTAAAATGCTTC
  CTCCCAGCATAGGATTCATTGAGTTGGTTACTTCATATTGTTGC
  
  ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
• Restriction Sites: SgfI-MluI
• OTI Disclaimer: Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
• Product Components: The cDNA clone is shipped in a 2-D bar-coded Matrix tube as 10 ug dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.

Reference Data

• RefSeq: NM_198175.1
• Summary: 'This gene (NME1) was identified because of its reduced mRNA transcript levels in highly metastatic cells. Nucleoside diphosphate kinase (NDK) exists as a hexamer composed of 'A' (encoded by this gene) and 'B' (encoded by NME2) isoforms. Mutations in this gene have been identified in aggressive neuroblastomas. Two transcript variants encoding different isoforms have been found for this gene. Co-transcription of this gene and the neighboring downstream gene (NME2) generates naturally-occurring transcripts (NME1-NME2), which encodes a fusion protein comprised of sequence sharing identity with each individual gene product. [provided by RefSeq, Jul 2008]'
• Locus ID: 4830