MMP9 (NM_004994) Human 3' UTR Clone

CAT#: SC202997

3`UTR clone of matrix metallopeptidase 9 (gelatinase B 92kDa gelatinase 92kDa type IV collagenase) (MMP9) for miRNA target validation

Specifications

Product Data

• Vector: pMirTarget
• Species: Human
• Transfection Reporter: RFP
• Assay Reporter: Luciferase
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Symbol: MMP9
• Synonyms: CLG4B; GELB; MANDP2; MMP-9
• ACCN: NM_004994
• Insert Size: 229 bp
• Sequence Data:
  Insert Sequence

  >SC202997 3'UTR clone of NM_004994
  The sequence shown below is from the reference sequence of NM_004994. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon
  
  
  CAATTGGCAGAGCTCAGAATTCAAGCGATCGC
  
  CGTGACCTATGACATCCTGCAGTGCCCTGAGGACTAGGGCTCCCGTCCTGCTTTGGCAGTGCCATGTAAA
  TCCCCACTGGGACCAACCCTGGGGAAGGAGCCAGTTTGCCGGATACAAACTGGTATTCTGTTCTGGAGGA
  AAGGGAGGAGTGGAGGTGGGCTGGGCCCTCTCTTCTCACCTTTGTTTTTTGTTGGAGTGTTTCTAATAAA
  CTTGGATTCTCTAACCTTT
  
  ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
• Restriction Sites: SgfI-MluI
• OTI Disclaimer: Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
• Product Components: The cDNA clone is shipped in a 2-D bar-coded Matrix tube as 10 ug dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.

Reference Data

• RefSeq: NM_004994.2
• Summary: 'Proteins of the matrix metalloproteinase (MMP) family are involved in the breakdown of extracellular matrix in normal physiological processes, such as embryonic development, reproduction, and tissue remodeling, as well as in disease processes, such as arthritis and metastasis. Most MMP's are secreted as inactive proproteins which are activated when cleaved by extracellular proteinases. The enzyme encoded by this gene degrades type IV and V collagens. Studies in rhesus monkeys suggest that the enzyme is involved in IL-8-induced mobilization of hematopoietic progenitor cells from bone marrow, and murine studies suggest a role in tumor-associated tissue remodeling. [provided by RefSeq, Jul 2008]'
• Locus ID: 4318