SIGLEC9 (NM_014441) Human 3' UTR Clone

CAT#: SC203064

3`UTR clone of sialic acid binding Ig-like lectin 9 (SIGLEC9) for miRNA target validation

Specifications

Product Data

• Vector: pMirTarget
• Species: Human
• Transfection Reporter: RFP
• Assay Reporter: Luciferase
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Symbol: SIGLEC9
• Synonyms: CD329; CDw329; FOAP-9; OBBP-LIKE; siglec-9
• ACCN: NM_014441
• Insert Size: 242
• Sequence Data:
  Insert Sequence

  >SC203064 3'UTR clone of NM_014441
  The sequence shown below is from the reference sequence of NM_014441. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon
  
  
  CAATTGGCAGAGCTCAGAATTCAAGCGATCGC
  
  GCCACTGACACCGAGTACTCGGAGATCAAGATCCACAGATGAGAAACTGCAGAGACTCACCCTGATTGAG
  GGATCACAGCCCCTCCAGGCAAGGGAGAAGTCAGAGGCTGATTCTTGTAGAATTAACAGCCCTCAACGTG
  ATGAGCTATGATAACACTATGAATTATGTGCAGAGTGAAAAGCACACAGGCTTTAGAGTCAAAGTATCTC
  AAACCTGAATCCACACTGTGCCCTCCCTTTTA
  
  ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
• Restriction Sites: SgfI-MluI
• OTI Disclaimer: Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).

Reference Data

• RefSeq: NM_014441.1
• Summary: Putative adhesion molecule that mediates sialic-acid dependent binding to cells. Preferentially binds to alpha-2,3- or alpha-2,6-linked sialic acid. The sialic acid recognition site may be masked by cis interactions with sialic acids on the same cell surface. [UniProtKB/Swiss-Prot Function]
• Locus ID: 27180