Integrin beta 7 (ITGB7) (NM_000889) Human 3' UTR Clone

CAT#: SC203071

3`UTR clone of integrin beta 7 (ITGB7) for miRNA target validation

Specifications

Product Data

• Vector: pMirTarget
• Species: Human
• Transfection Reporter: RFP
• Assay Reporter: Luciferase
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Symbol: ITGB7
• ACCN: NM_000889
• Insert Size: 248 bp
• Sequence Data:
  Insert Sequence

  >SC203071 3'UTR clone of NM_000889
  The sequence shown below is from the reference sequence of NM_000889. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon
  
  
  CAATTGGCAGAGCTCAGAATTCAAGCGATCGC
  
  CCACCATCAATCCTCGCTTTCAAGAGGCAGACAGTCCCACTCTCTGAAGGAGGGAGGGACACTTACCCAA
  GGCTCTTCTCCTTGGAGGACAGTGGGAACTGGAGGGTGAGAGGAAGGGTGGGTCTGTAAGACCTTGGTAG
  GGGACTAATTCACTGGCGAGGTGCGGCCACCACCCTACTTCATTTTCAGAGTGACACCCAAGAGGGCTGC
  TTCCCATGCCTGCAACCTTGCATCCATCTGGGCTACCC
  
  ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
• Restriction Sites: SgfI-MluI
• OTI Disclaimer: Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
• Product Components: The cDNA clone is shipped in a 2-D bar-coded Matrix tube as 10 ug dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.

Reference Data

• RefSeq: NM_000889.1
• Summary: 'This gene encodes a protein that is a member of the integrin superfamily. Members of this family are adhesion receptors that function in signaling from the extracellular matrix to the cell. Integrins are heterodimeric integral membrane proteins composed of an alpha chain and a beta chain. The encoded protein forms dimers with an alpha4 chain or an alphaE chain and plays a role in leukocyte adhesion. Dimerization with alpha4 forms a homing receptor for migration of lymphocytes to the intestinal mucosa and Peyer's patches. Dimerization with alphaE permits binding to the ligand epithelial cadherin, a calcium-dependent adhesion molecule. Alternate splicing results in multiple transcript variants. Additional alternatively spliced transcript variants of this gene have been described, but their full-length nature is not known. [provided by RefSeq, Sep 2013]'
• Locus ID: 3695