DR4 (TNFRSF10A) (NM_003844) Human 3' UTR Clone

CAT#: SC203094

3`UTR clone of tumor necrosis factor receptor superfamily member 10a (TNFRSF10A) for miRNA target validation

Specifications

Product Data

• Vector: pMirTarget
• Species: Human
• Transfection Reporter: RFP
• Assay Reporter: Luciferase
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Symbol: TNFRSF10A
• Synonyms: APO2; CD261; DR4; TRAILR-1; TRAILR1
• ACCN: NM_003844
• Insert Size: 245
• Sequence Data:
  Insert Sequence

  >SC203094 3'UTR clone of NM_003844
  The sequence shown below is from the reference sequence of NM_003844. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon
  
  
  CAATTGGCAGAGCTCAGAATTCAAGCGATCGC
  
  AGAAGATGGCACAGGCTCTGCCGTGTCCTTGGAGTGAAAGACTCTTTTTACCAGAGGTTTCCTCTTAGGT
  GTTAGGAGTTAATACATATTAGGTTTTTTTTTTTTTTAACATGTATACAAAGTAAATTCTTAGCCAGGTG
  TAGTGGCTCATGCCTGTAATCCCAGCACTTTGGGAGGCTGAGGCGGGTGGATCACTTGAGGTCAGAAGTT
  CAAGACCAGCCTGACCAACATCGTGAAATGCCGTC
  
  ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
• Restriction Sites: SgfI-MluI
• OTI Disclaimer: Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).

Reference Data

• RefSeq: NM_003844.3
• Summary: The protein encoded by this gene is a member of the TNF-receptor superfamily. This receptor is activated by tumor necrosis factor-related apoptosis inducing ligand (TNFSF10/TRAIL), and thus transduces cell death signal and induces cell apoptosis. Studies with FADD-deficient mice suggested that FADD, a death domain containing adaptor protein, is required for the apoptosis mediated by this protein. [provided by RefSeq, Jul 2008]
• Locus ID: 8797