TSG101 (NM_006292) Human 3' UTR Clone

CAT#: SC203096

3`UTR clone of tumor susceptibility gene 101 (TSG101) for miRNA target validation

Specifications

Product Data

• Vector: pMirTarget
• Species: Human
• Transfection Reporter: RFP
• Assay Reporter: Luciferase
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Symbol: TSG101
• Synonyms: TSG10; VPS23
• ACCN: NM_006292
• Insert Size: 236
• Sequence Data:
  Insert Sequence

  >SC203096 3'UTR clone of NM_006292
  The sequence shown below is from the reference sequence of NM_006292. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon
  
  
  CAATTGGCAGAGCTCAGAATTCAAGCGATCGC
  
  GGTCTCAGTGACCTCTACTGACTTCTCTGATACCAGCTGGAGGTTGAGCTCTTCTTAAAGTATTCTTCTC
  TTCCTTTTATCAGTAGGTGCCCAGAATAAGTTATTGCAGTTTATCATTCAAGTGTAAAATATTTTGAATC
  AATAATATATTTTCTGTTTTCTTTTGGTAAAGACTGGCTTTTATTAATGCACTTTCTATCCTCTGTAAAC
  TTTTTGTGCTGAATGTTGGGACTGCT
  
  ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
• Restriction Sites: SgfI-MluI
• OTI Disclaimer: Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).

Reference Data

• RefSeq: NM_006292.2
• Summary: The protein encoded by this gene belongs to a group of apparently inactive homologs of ubiquitin-conjugating enzymes. The gene product contains a coiled-coil domain that interacts with stathmin, a cytosolic phosphoprotein implicated in tumorigenesis. The protein may play a role in cell growth and differentiation and act as a negative growth regulator. In vitro steady-state expression of this tumor susceptibility gene appears to be important for maintenance of genomic stability and cell cycle regulation. Mutations and alternative splicing in this gene occur in high frequency in breast cancer and suggest that defects occur during breast cancer tumorigenesis and/or progression. [provided by RefSeq, Jul 2008]
• Locus ID: 7251