ALDH3A1 (NM_001135167) Human 3' UTR Clone

CAT#: SC203108

3`UTR clone of aldehyde dehydrogenase 3 family memberA1 (ALDH3A1) transcript variant 3 for miRNA target validation

Reconstitution Protocol

USD 560.00

4 Weeks*

Size
    • 10 ug

Product Images

Other products for "ALDH3A1"

Specifications

Product Data
Vector pMirTarget
Species Human
Transfection Reporter RFP
Assay Reporter Luciferase
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Symbol ALDH3A1
Synonyms ALDH3; ALDHIII
ACCN NM_001135167
Insert Size 237 bp
Sequence Data
>SC203108 3'UTR clone of NM_001135167
The sequence shown below is from the reference sequence of NM_001135167. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon


CAATTGGCAGAGCTCAGAATTCAAGCGATCGC

CAAGATGACCCAGCACTGAGGAGGGGTTGCTCCGCCTGGCCTGGCCATACTGTGTCCCATCGGAGTGCGG
ACCACCCTCACTGGCTCTCCTGGCCCTGGGAGAATCGCTCCTGCAGCCCCAGCCCAGCCCCACTCCTCTG
CTGACCTGCTGACCTGTGCACACCCCACTCCCACATGGGCCCAGGCCTCACCATTCCAAGTCTCCACCCC
TTTCTAGACCAATAAAGAGACGAATAC

ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as 10 ug dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.
Reference Data
RefSeq NM_001135167.1
Summary 'Aldehyde dehydrogenases oxidize various aldehydes to the corresponding acids. They are involved in the detoxification of alcohol-derived acetaldehyde and in the metabolism of corticosteroids, biogenic amines, neurotransmitters, and lipid peroxidation. The enzyme encoded by this gene forms a cytoplasmic homodimer that preferentially oxidizes aromatic and medium-chain (6 carbons or more) saturated and unsaturated aldehyde substrates. It is thought to promote resistance to UV and 4-hydroxy-2-nonenal-induced oxidative damage in the cornea. The gene is located within the Smith-Magenis syndrome region on chromosome 17. Multiple alternatively spliced variants, encoding the same protein, have been identified. [provided by RefSeq, Sep 2008]'
Locus ID 218

Documents

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.