VAV1 (NM_005428) Human 3' UTR Clone

CAT#: SC203138

3`UTR clone of vav 1 guanine nucleotide exchange factor (VAV1) for miRNA target validation

Specifications

Product Data

• Vector: pMirTarget
• Species: Human
• Transfection Reporter: RFP
• Assay Reporter: Luciferase
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Symbol: VAV1
• Synonyms: VAV
• ACCN: NM_005428
• Insert Size: 272
• Sequence Data:
  Insert Sequence

  >SC203138 3'UTR clone of NM_005428
  The sequence shown below is from the reference sequence of NM_005428. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon
  
  
  CAATTGGCAGAGCTCAGAATTCAAGCGATCGC
  
  TGCCAACTACGTGGAGGAAGATTATTCTGAATACTGCTGAGCCCTGGTGCCTTGGCAGAGAGACGAGAAA
  CTCCAGGCTCTGAGCCCGGCGTGGGCAGGCAGCGGAGCCAGGGGCTGTGACAGCTCCCGGCGGGTGGAGA
  CTTTGGGATGGACTGGAGGAGCGCAGCGTCCAGCTGGCGGTGCTCCCGGGATGTGCCCTGACATGGTTAA
  TTTATAACACCCCGATTTCCTCTTGGGTCCCCTCAAGCAGACGGGGCTCAAGGGGGTTACAT
  
  ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
• Restriction Sites: SgfI-MluI
• OTI Disclaimer: Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).

Reference Data

• RefSeq: NM_005428.2
• Summary: This gene is a member of the VAV gene family. The VAV proteins are guanine nucleotide exchange factors (GEFs) for Rho family GTPases that activate pathways leading to actin cytoskeletal rearrangements and transcriptional alterations. The encoded protein is important in hematopoiesis, playing a role in T-cell and B-cell development and activation. The encoded protein has been identified as the specific binding partner of Nef proteins from HIV-1. Coexpression and binding of these partners initiates profound morphological changes, cytoskeletal rearrangements and the JNK/SAPK signaling cascade, leading to increased levels of viral transcription and replication. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Apr 2012]
• Locus ID: 7409