CYP2A7 (NM_030589) Human 3' UTR Clone

CAT#: SC203158

3`UTR clone of cytochrome P450 family 2 subfamily A polypeptide 7 (CYP2A7) transcript variant 2 for miRNA target validation

Specifications

Product Data

• Vector: pMirTarget
• Species: Human
• Transfection Reporter: RFP
• Assay Reporter: Luciferase
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Symbol: CYP2A7
• Synonyms: CPA7; CPAD; CYP2A; CYPIIA7; P450-IIA4
• ACCN: NM_030589
• Insert Size: 269
• Sequence Data:
  Insert Sequence

  >SC203158 3'UTR clone of NM_030589
  The sequence shown below is from the reference sequence of NM_030589. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon
  
  
  CAATTGGCAGAGCTCAGAATTCAAGCGATCGC
  
  CTACACCATGAGCTTCCTGCCCCGCTGAGCGAGGGCTGTGCCGGTGCAGGTCTGGTGGGCGGGGCCAGGG
  AAAGGCGGGGTCAGGGCGGGGTTCGCGGAAGAGGCGGGTATAAGAATGGGGGGAAGATGCGGGAAAGGAA
  GGGGCGTGGTGGCTAGAGGGAAGAGAAGAAACAGAAGCGGCTCAGTTCACCTTGATAAGGTGCTTCCGAG
  CTGGGATGAGAGGAAGGGAAACCTTACATTATGCTATGAAGAGTAGTAATAATAGCAGC
  
  ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
• Restriction Sites: SgfI-MluI
• OTI Disclaimer: Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).

Reference Data

• RefSeq: NM_030589.2
• Summary: This gene encodes a member of the cytochrome P450 superfamily of enzymes. The cytochrome P450 proteins are monooxygenases which catalyze many reactions involved in drug metabolism and synthesis of cholesterol, steroids and other lipids. This protein localizes to the endoplasmic reticulum; its substrate has not yet been determined. This gene, which produces two transcript variants, is part of a large cluster of cytochrome P450 genes from the CYP2A, CYP2B and CYP2F subfamilies on chromosome 19q. [provided by RefSeq, Jul 2008]
• Locus ID: 1549