LIPT2 (NM_001144869) Human 3' UTR Clone

CAT#: SC203186

3`UTR clone of lipoyl(octanoyl) transferase 2 (putative) (LIPT2) for miRNA target validation

Specifications

Product Data

• Vector: pMirTarget
• Species: Human
• Transfection Reporter: RFP
• Assay Reporter: Luciferase
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Symbol: LIPT2
• ACCN: NM_001144869
• Insert Size: 262
• Sequence Data:
  Insert Sequence

  >SC203186 3'UTR clone of NM_001144869
  The sequence shown below is from the reference sequence of NM_001144869. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon
  
  
  CAATTGGCAGAGCTCAGAATTCAAGCGATCGC
  
  CACTGATCTCAGAGGACAGCCCCAACTGAAGAGTACTCATAACAGCCAGGATGCTCCTGCCTTGGGAAGC
  ATGAAGTCTGACTTGAGTCACCTACTGAAACCCAGATTTTAGACCTGGCCTGTCATTCACTGATCATGAA
  ACTAAGGACATACCATGAGCTCTGAGCCACTATTTTCATATGTATCCTGTTTTATTTATATCTTCCCCAC
  CTACCTCAGAGATACTAGATGTGACAATACTGTGAAAAGCAACACATGCTAT
  
  ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
• Restriction Sites: SgfI-MluI
• OTI Disclaimer: Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).

Reference Data

• RefSeq: NM_001144869.1
• Summary: This gene encodes a mitochondrial protein that catalyzes the transfer of octanoic acid to lipoate-dependent enzymes such as octanoyl-ACP. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Aug 2016]
• Locus ID: 387787