Hsc70 (HSPA8) (NM_153201) Human 3' UTR Clone

CAT#: SC203198

3`UTR clone of heat shock 70kDa protein 8 (HSPA8) transcript variant 2 for miRNA target validation

Specifications

Product Data

• Vector: pMirTarget
• Species: Human
• Transfection Reporter: RFP
• Assay Reporter: Luciferase
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Symbol: HSPA8
• Synonyms: HEL-33; HEL-S-72p; HSC54; HSC70; HSC71; HSP71; HSP73; HSPA10; LAP-1; LAP1; NIP71
• ACCN: NM_153201
• Insert Size: 260 bp
• Sequence Data:
  Insert Sequence

  >SC203198 3'UTR clone of NM_153201
  The sequence shown below is from the reference sequence of NM_153201. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon
  
  
  CAATTGGCAGAGCTCAGAATTCAAGCGATCGC
  
  TCTGGTGGTGCTTCCTCAGGGCCCACCATTGAAGAGGTTGATTAAGCCAACCAAGTGTAGATGTAGCATT
  GTTCCACACATTTAAAACATTTGAAGGACCTAAATTCGTAGCAAATTCTGTGGCAGTTTTAAAAAGTTAA
  GCTGCTATAGTAAGTTACTGGGCATTCTCAATACTTGAATATGGAACATATGCACAGGGGAAGGAAATAA
  CATTGCACTTTATAAACACTGTATTGTAAGTGGAAAATGCAATGTCTTAA
  
  ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
• Restriction Sites: SgfI-MluI
• OTI Disclaimer: Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
• Product Components: The cDNA clone is shipped in a 2-D bar-coded Matrix tube as 10 ug dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.

Reference Data

• RefSeq: NM_153201.1
• Summary: 'This gene encodes a member of the heat shock protein 70 family, which contains both heat-inducible and constitutively expressed members. This protein belongs to the latter group, which are also referred to as heat-shock cognate proteins. It functions as a chaperone, and binds to nascent polypeptides to facilitate correct folding. It also functions as an ATPase in the disassembly of clathrin-coated vesicles during transport of membrane components through the cell. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Aug 2011]'
• Locus ID: 3312