Thyroid Peroxidase (TPO) (NM_175721) Human 3' UTR Clone

CAT#: SC203237

3`UTR clone of thyroid peroxidase (TPO) transcript variant 4 for miRNA target validation

Specifications

Product Data

• Vector: pMirTarget
• Species: Human
• Transfection Reporter: RFP
• Assay Reporter: Luciferase
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Symbol: TPO
• Synonyms: MSA; TDH2A; TPX
• ACCN: NM_175721
• Insert Size: 250 bp
• Sequence Data:
  Insert Sequence

  >SC203237 3'UTR clone of NM_175721
  The sequence shown below is from the reference sequence of NM_175721. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon
  
  
  CAATTGGCAGAGCTCAGAATTCAAGCGATCGC
  
  ACTCACAGGCTGCCGAGAGCCCTCTGAGGGCAAAGTGGCAGGACACTGCAGAACAGCTTCATGTTCCCAA
  AATCACCGTACGACTCTTTTCCAAACACAGGCAAATCCGAAATCAGCAGGACGACTGTTTTCCCAACACG
  GGTAAATCTAGTACCATGTCGTAGTTACTCTCAGGCATGGATGAATAAATGTTATAGCTGCATTTGTCTG
  GCCTTTTCTTGTAAACATTGCCTGATTTGTTCCTTCTGGG
  
  ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
• Restriction Sites: SgfI-MluI
• OTI Disclaimer: Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
• Product Components: The cDNA clone is shipped in a 2-D bar-coded Matrix tube as 10 ug dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.

Reference Data

• RefSeq: NM_175721.3
• Summary: 'This gene encodes a membrane-bound glycoprotein. The encoded protein acts as an enzyme and plays a central role in thyroid gland function. The protein functions in the iodination of tyrosine residues in thyroglobulin and phenoxy-ester formation between pairs of iodinated tyrosines to generate the thyroid hormones, thyroxine and triiodothyronine. Mutations in this gene are associated with several disorders of thyroid hormonogenesis, including congenital hypothyroidism, congenital goiter, and thyroid hormone organification defect IIA. Multiple transcript variants encoding distinct isoforms have been identified for this gene, but the full-length nature of some variants has not been determined. [provided by RefSeq, May 2011]'
• Locus ID: 7173