NALP2 (NLRP2) (NM_017852) Human 3' UTR Clone

CAT#: SC203243

3`UTR clone of NLR family pyrin domain containing 2 (NLRP2) for miRNA target validation

Specifications

Product Data

• Vector: pMirTarget
• Species: Human
• Transfection Reporter: RFP
• Assay Reporter: Luciferase
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Symbol: NLRP2
• Synonyms: CLR19.9; NALP2; NBS1; PAN1; PYPAF2
• ACCN: NM_017852
• Insert Size: 285
• Sequence Data:
  Insert Sequence

  >SC203243 3'UTR clone of NM_017852
  The sequence shown below is from the reference sequence of NM_017852. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon
  
  
  CAATTGGCAGAGCTCAGAATTCAAGCGATCGC
  
  ATCATCCCTGGGCAGAAAGGCCTTCTTCTCATGACTTCATGATCTGAATCCCCCCGAGTCATTCATTCTC
  CATGAAGTCATCGATTTTCCAGGTGTTGGTGAACTGCCTGTGACTCCTCTCCTCCCCGGCCCCTACCCCT
  CAGGGATAATGAGTTCATTGCTGGGCTAGATGTTTTAGCCATGATTCTGCCTCTGTTTTATACCTGCACA
  CATCCTTATCTTTGTTACATATGAAATATCTGTATCACGGGTATATTGAGAGAAATAAAGGTGAGAGCAT
  TCACA
  
  ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
• Restriction Sites: SgfI-MluI
• OTI Disclaimer: Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).

Reference Data

• RefSeq: NM_017852.3
• Summary: This gene is a member of the nucleotide-binding and leucine-rich repeat receptor (NLR) family, and is predicted to contain an N-terminal pyrin effector domain (PYD), a centrally-located nucleotide-binding and oligomerization domain (NACHT) and C-terminal leucine-rich repeats (LRR). Members of this gene family are thought to be important regulators of immune responses. This gene product interacts with components of the IkB kinase (IKK) complex, and can regulate both caspase-1 and NF-kB (nuclear factor kappa-light-chain-enhancer of activated B cells) activity. The pyrin domain is necessary and sufficient for suppression of NF-kB activity. An allelic variant (rs147585490) has been found that is incapable of blocking the transcriptional activity of NF-kB. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Dec 2016]
• Locus ID: 55655