UGT2B28 (NM_053039) Human 3' UTR Clone

CAT#: SC203244

3`UTR clone of UDP glucuronosyltransferase 2 family polypeptide B28 (UGT2B28) for miRNA target validation

Specifications

Product Data

• Vector: pMirTarget
• Species: Human
• Transfection Reporter: RFP
• Assay Reporter: Luciferase
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Symbol: UGT2B28
• Synonyms: UDP-glucuronosyltransferase 2B28; UDP glucuronosyltransferase 2 family, polypeptide B28; UDP glycosyltransferase 2 family, polypeptide B28
• ACCN: NM_053039
• Insert Size: 259
• Sequence Data:
  Insert Sequence

  >SC203244 3'UTR clone of NM_053039
  The sequence shown below is from the reference sequence of NM_053039. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon
  
  
  CAATTGGCAGAGCTCAGAATTCAAGCGATCGC
  
  CTGGAAGTTTGCTAGAAAAGGGAAGAAGGGAAAAAGAGATTAGTTATGTCTGACATTTGAAGCTGGAAAA
  CCAGATAGATGGGTTGACATCAGTTTATTCCAGCAAGAAAGAAAAGATTGTTATGCAAGATTTCTTTCTT
  CCTGTGACAAAAAAAAAAACTTTTCAAAATCTACCTTGTCAAGTAAAAATTTGTTTTTCAGAGATTTACC
  ACCCAGGTAATGGTTAGAAATATTCTGTGGCAATGAAGAAAACACTAGG
  
  ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
• Restriction Sites: SgfI-MluI
• OTI Disclaimer: Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).

Reference Data

• RefSeq: NM_053039.1
• Summary: This gene encodes a member of the uridine diphosphoglucuronosyltransferase protein family. The encoded enzyme catalyzes the transfer of glucuronic acid from uridine diphosphoglucuronic acid to a diverse array of substrates including steroid hormones and lipid-soluble drugs. This process, known as glucuronidation, is an intermediate step in the metabolism of steroids. Two transcript variants encoding different isoforms have been found for this gene. While both isoforms are targeted to the endoplasmic reticulum, only the longer isoform appears to be active. [provided by RefSeq, May 2011]
• Locus ID: 54490