BEX2 (NM_032621) Human 3' UTR Clone

CAT#: SC203247

3`UTR clone of brain expressed X-linked 2 (BEX2) for miRNA target validation

Specifications

Product Data

• Vector: pMirTarget
• Species: Human
• Transfection Reporter: RFP
• Assay Reporter: Luciferase
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Symbol: BEX2
• Synonyms: BEX1; DJ79P11.1
• ACCN: NM_032621
• Insert Size: 251
• Sequence Data:
  Insert Sequence

  >SC203247 3'UTR clone of NM_032621
  The sequence shown below is from the reference sequence of NM_032621. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon
  
  
  CAATTGGCAGAGCTCAGAATTCAAGCGATCGC
  
  CCATCACGATGAGTTTTGCCTTATGCCCTGAATCCTGATGGTTTCCCTGAAGTTAATAGGGAGACCCCTG
  CTTCCTAAACTTACACATTTGTGGTGTACCTTTGTCGTAAACGTTTTGATGTTACCTATTTCTTGTGGGT
  CTCCTATTACCAGCTTCTAAATGAATGTTGTTTTTGACCCAGTTTGTAAGTTTCTGTCAGCAGGAGAGTT
  TTACCTATTGCATGGAAAGATGCTCATTATATATTGTGAAG
  
  ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
• Restriction Sites: SgfI-MluI
• OTI Disclaimer: Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).

Reference Data

• RefSeq: NM_032621.3
• Summary: This gene belongs to the brain expressed X-linked gene family. The encoded protein interacts with the transcription factor LIM domain only 2 in a DNA-binding complex that recognizes the E-box element and promotes transcription. This gene has been found to be a tumor suppressor that is silenced in human glioma. In breast cancer cells, this gene product modulates apoptosis in response to estrogen and tamoxifen, and enhances the anti-proliferative effect of tamoxifen. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Dec 2009]
• Locus ID: 84707