Granzyme H (GZMH) (NM_033423) Human 3' UTR Clone

CAT#: SC203251

3`UTR clone of granzyme H (cathepsin G-like 2 protein h-CCPX) (GZMH) for miRNA target validation

Specifications

Product Data

• Vector: pMirTarget
• Species: Human
• Transfection Reporter: RFP
• Assay Reporter: Luciferase
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Symbol: GZMH
• Synonyms: CCP-X; CGL-2; CSP-C; CTLA1; CTSGL2
• ACCN: NM_033423
• Insert Size: 139 bp
• Sequence Data:
  Insert Sequence

  >SC203251 3'UTR clone of NM_033423
  The sequence shown below is from the reference sequence of NM_033423. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon
  
  
  CAATTGGCAGAGCTCAGAATTCAAGCGATCGC
  
  ACACTTCCTGCCCTGGATAAAGAGAACAATGAAGCGCCTCTAACAGCAGGCATGAGACTAACCTTCCTCT
  GGGCCTGACCATCTCTGGGACAGAGGCAAGAATCCCCAAGGGGTGGGCAGTCAGGGTTGCAGGACTGTA
  
  ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
• Restriction Sites: SgfI-MluI
• OTI Disclaimer: Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
• Product Components: The cDNA clone is shipped in a 2-D bar-coded Matrix tube as 10 ug dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.

Reference Data

• RefSeq: NM_033423.3
• Summary: 'This gene encodes a member of the peptidase S1 family of serine proteases. Alternative splicing results in multiple transcript variants, at least one of which encodes a preproprotein that is proteolytically processed to generate a chymotrypsin-like protease. This protein is reported to be constitutively expressed in the NK (natural killer) cells of the immune system and may play a role in the cytotoxic arm of the innate immune response by inducing target cell death and by directly cleaving substrates in pathogen-infected cells. This gene is present in a gene cluster with another member of the granzyme subfamily on chromosome 14. [provided by RefSeq, Nov 2015]'
• Locus ID: 2999