Fibrinogen gamma chain (FGG) (NM_021870) Human 3' UTR Clone

CAT#: SC203258

3`UTR clone of fibrinogen gamma chain (FGG) transcript variant gamma-B for miRNA target validation

Reconstitution Protocol

USD 560.00

4 Weeks*

Size
    • 10 ug

Product Images

Specifications

Product Data
Vector pMirTarget
Species Human
Transfection Reporter RFP
Assay Reporter Luciferase
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Symbol FGG
Synonyms fibrinogen, gamma chain; fibrinogen, gamma polypeptide; fibrinogen gamma chain
ACCN NM_021870
Insert Size 278 bp
Sequence Data
>SC203258 3'UTR clone of NM_021870
The sequence shown below is from the reference sequence of NM_021870. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon


CAATTGGCAGAGCTCAGAATTCAAGCGATCGC

TGCGGAAACAGAATATGACTCACTTTACCCTGAGGATGATTTGTAGAAAATTAACTGCTAACTTCTATTG
ACCCACAAAGTTTCAGAAATTCTCTGAAAGTTTCTTCCTTTTTTCTCTTACTATATTTATTGATTTCAAG
TCTTCTATTAAGGACATTTAGCCTTCAATGGAAATTAAAACTCATTTAGGACTGTATTTCCAAATTACTG
ATATCAGAGTTATTTAAAAATTGTTTATTTGAGGAGATAACATTTCAACTTTGTTCCTAAATATATAA

ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as 10 ug dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.
Reference Data
RefSeq NM_021870.2
Summary 'The protein encoded by this gene is the gamma component of fibrinogen, a blood-borne glycoprotein comprised of three pairs of nonidentical polypeptide chains. Following vascular injury, fibrinogen is cleaved by thrombin to form fibrin which is the most abundant component of blood clots. In addition, various cleavage products of fibrinogen and fibrin regulate cell adhesion and spreading, display vasoconstrictor and chemotactic activities, and are mitogens for several cell types. Mutations in this gene lead to several disorders, including dysfibrinogenemia, hypofibrinogenemia and thrombophilia. Alternative splicing results in transcript variants encoding different isoforms. [provided by RefSeq, Aug 2015]'
Locus ID 2266

Documents

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.