HPS6 (NM_024747) Human 3' UTR Clone

CAT#: SC203269

3`UTR clone of Hermansky-Pudlak syndrome 6 (HPS6) for miRNA target validation

Specifications

Product Data

• Vector: pMirTarget
• Species: Human
• Transfection Reporter: RFP
• Assay Reporter: Luciferase
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Symbol: HPS6
• Synonyms: BLOC2S3
• ACCN: NM_024747
• Insert Size: 228
• Sequence Data:
  Insert Sequence

  >SC203269 3'UTR clone of NM_024747
  The sequence shown below is from the reference sequence of NM_024747. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon
  
  
  CAATTGGCAGAGCTCAGAATTCAAGCGATCGC
  
  ACTCCACCTCGGGACCTATGACTACCCTTCAGGCATCAGAACACTCAGGGCCTGGAGGCTTGCTTGGGAC
  TGGAGGCTTGCTTGGACAGTTCCTCTGTGTCACTGACACAGGAAATCATTTCTAGGACACAGTGATCAGG
  GAAGGGTGCCTGGGACTTGGAGGGTCCCATGTATGGACCTGTGTATGCAATACTGTTCTGTCATCTGGAG
  CTATTTTTAAGATGTGTG
  
  ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
• Restriction Sites: SgfI-MluI
• OTI Disclaimer: Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).

Reference Data

• RefSeq: NM_024747.4
• Summary: This intronless gene encodes a protein that may play a role in organelle biogenesis associated with melanosomes, platelet dense granules, and lysosomes. This protein interacts with Hermansky-Pudlak syndrome 5 protein. Mutations in this gene are associated with Hermansky-Pudlak syndrome type 6. [provided by RefSeq, Jul 2008]
• Locus ID: 79803