VTI1B (NM_006370) Human 3' UTR Clone

CAT#: SC203291

3`UTR clone of vesicle transport through interaction with t-SNAREs homolog 1B (yeast) (VTI1B) for miRNA target validation

Specifications

Product Data

• Vector: pMirTarget
• Species: Human
• Transfection Reporter: RFP
• Assay Reporter: Luciferase
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Symbol: VTI1B
• Synonyms: v-SNARE; VTI1; VTI1-LIKE; vti1-rp1; VTI1L; VTI2
• ACCN: NM_006370
• Insert Size: 228
• Sequence Data:
  Insert Sequence

  >SC203291 3'UTR clone of NM_006370
  The sequence shown below is from the reference sequence of NM_006370. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon
  
  
  CAATTGGCAGAGCTCAGAATTCAAGCGATCGC
  
  ATTCTTTCGCAGCCATTGAACTTCTATAGGGAAGGGTTTGTGGACCAGAACTTTGACCTTGTGAATGCAT
  GATGTTAGGGATGTGGATAGAATAAGCATATTGCTGCTGTGGGCTGACAGTTCAAGGATGCACTGTATAG
  CCAGGCTGTGGGAGGAGGGAGGAAAGATGAAAAACCACTTAAATGTGAAGGAACAACAGCAACAAGACCA
  GTATGATATACCAAGGTA
  
  ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
• Restriction Sites: SgfI-MluI
• OTI Disclaimer: Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).

Reference Data

• RefSeq: NM_006370.2
• Summary: V-SNARE that mediates vesicle transport pathways through interactions with t-SNAREs on the target membrane. These interactions are proposed to mediate aspects of the specificity of vesicle trafficking and to promote fusion of the lipid bilayers. May be concerned with increased secretion of cytokines associated with cellular senescence. [UniProtKB/Swiss-Prot Function]
• Locus ID: 10490