DPM1 (NM_003859) Human 3' UTR Clone

CAT#: SC203320

3`UTR clone of dolichyl-phosphate mannosyltransferase polypeptide 1 catalytic subunit (DPM1) for miRNA target validation

Specifications

Product Data

• Vector: pMirTarget
• Species: Human
• Transfection Reporter: RFP
• Assay Reporter: Luciferase
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Symbol: DPM1
• Synonyms: CDGIE; MPDS
• ACCN: NM_003859
• Insert Size: 278
• Sequence Data:
  Insert Sequence

  >SC203320 3'UTR clone of NM_003859
  The sequence shown below is from the reference sequence of NM_003859. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon
  
  
  CAATTGGCAGAGCTCAGAATTCAAGCGATCGC
  
  CTTTCTTGAAAGGATTATTGACTCTTTTTGCTACTACATAAAAGAAAGATACTCATTTATAGTTACGTTC
  ATTTCAGGTTAAACATGAAAGAAGCCTGGTTACTGATTTGTATAAAATGTACTCTTAAAGTATAAAATAT
  AAGGTAAGGTAAATTTCATGCATCTTTTTATGAAGACCACCTATTTTATATTTCAAATTAAATAATTTTA
  AAGTTGCTGGCCTAATGAGCAATGTTCTCAATTTTCGTTTTCATTTTGCTGTATTGAGACCTATAAAT
  
  ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
• Restriction Sites: SgfI-MluI
• OTI Disclaimer: Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).

Reference Data

• RefSeq: NM_003859.1
• Summary: Dolichol-phosphate mannose (Dol-P-Man) serves as a donor of mannosyl residues on the lumenal side of the endoplasmic reticulum (ER). Lack of Dol-P-Man results in defective surface expression of GPI-anchored proteins. Dol-P-Man is synthesized from GDP-mannose and dolichol-phosphate on the cytosolic side of the ER by the enzyme dolichyl-phosphate mannosyltransferase. Human DPM1 lacks a carboxy-terminal transmembrane domain and signal sequence and is regulated by DPM2. Mutations in this gene are associated with congenital disorder of glycosylation type Ie. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Nov 2015]
• Locus ID: 8813