Factor H (CFH) (NM_000186) Human 3' UTR Clone

CAT#: SC203323

3`UTR clone of complement factor H (CFH) transcript variant 1 for miRNA target validation

Specifications

Product Data

• Vector: pMirTarget
• Species: Human
• Transfection Reporter: RFP
• Assay Reporter: Luciferase
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Symbol: CFH
• Synonyms: AHUS1; AMBP1; ARMD4; ARMS1; CFHL3; FH; FHL1; HF; HF1; HF2; HUS
• ACCN: NM_000186
• Insert Size: 215 bp
• Sequence Data:
  Insert Sequence

  >SC203323 3'UTR clone of NM_000186
  The sequence shown below is from the reference sequence of NM_000186. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon
  
  
  CAATTGGCAGAGCTCAGAATTCAAGCGATCGC
  
  CTGGAGTATCCAACTTGTGCAAAAAGATAGAATCAATCATAAAGTGCACACCTTTATTCAGAACTTTAGT
  ATTAAATCAGTTCTCAATTTCATTTTTTATGTATTGTTTTACTCCTTTTTATTCATACGTAAAATTTTGG
  ATTAATTTGTGAAAATGTAATTATAAGCTGAGACCGGTGGCTCTCTTCTTAAAAGCACCATATTAAATCC
  TGGAA
  
  ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
• Restriction Sites: SgfI-MluI
• OTI Disclaimer: Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
• Product Components: The cDNA clone is shipped in a 2-D bar-coded Matrix tube as 10 ug dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.

Reference Data

• RefSeq: NM_000186.3
• Summary: 'This gene is a member of the Regulator of Complement Activation (RCA) gene cluster and encodes a protein with twenty short consensus repeat (SCR) domains. This protein is secreted into the bloodstream and has an essential role in the regulation of complement activation, restricting this innate defense mechanism to microbial infections. Mutations in this gene have been associated with hemolytic-uremic syndrome (HUS) and chronic hypocomplementemic nephropathy. Alternate transcriptional splice variants, encoding different isoforms, have been characterized. [provided by RefSeq, Oct 2011]'
• Locus ID: 3075