GGH (NM_003878) Human 3' UTR Clone

CAT#: SC203333

3`UTR clone of gamma-glutamyl hydrolase (conjugase folylpolygammaglutamyl hydrolase) (GGH) for miRNA target validation

Specifications

Product Data

• Vector: pMirTarget
• Species: Human
• Transfection Reporter: RFP
• Assay Reporter: Luciferase
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Symbol: GGH
• Synonyms: GH
• ACCN: NM_003878
• Insert Size: 260
• Sequence Data:
  Insert Sequence

  >SC203333 3'UTR clone of NM_003878
  The sequence shown below is from the reference sequence of NM_003878. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon
  
  
  CAATTGGCAGAGCTCAGAATTCAAGCGATCGC
  
  TTCTTCATTTCAGCAATGTTACATATTTGATTGAAAGTCTTCAATTTGTTAACAGAGCAAATTTGAATAA
  TTCCATGATTAAACTGTTAGAATAACTTGCTACTCATGGCAAGATTAGGAAGTCACAGATTCTTTTCTAT
  AATGTGCCTGGCTCTGATTCTTCATTCTGTATGTGACTATTTATATAACATTAGATAATTAAATAGTGAG
  ACATAAATAGAGTGTTTTTCATGGAAAAGCCTTCTTATATCTGAAGATTG
  
  ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
• Restriction Sites: SgfI-MluI
• OTI Disclaimer: Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).

Reference Data

• RefSeq: NM_003878.2
• Summary: This gene catalyzes the hydrolysis of folylpoly-gamma-glutamates and antifolylpoly-gamma-glutamates by the removal of gamma-linked polyglutamates and glutamate. [provided by RefSeq, Jul 2008]
• Locus ID: 8836