beta 1 Spectrin (SPTB) (NM_000347) Human 3' UTR Clone

CAT#: SC203338

3`UTR clone of spectrin beta erythrocytic (SPTB) transcript variant 2 for miRNA target validation

Specifications

Product Data

• Vector: pMirTarget
• Species: Human
• Transfection Reporter: RFP
• Assay Reporter: Luciferase
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Symbol: SPTB
• Synonyms: EL3; HS2; HSPTB1; SPH2
• ACCN: NM_000347
• Insert Size: 298 bp
• Sequence Data:
  Insert Sequence

  >SC203338 3'UTR clone of NM_000347
  The sequence shown below is from the reference sequence of NM_000347. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon
  
  
  CAATTGGCAGAGCTCAGAATTCAAGCGATCGC
  
  TAGTTCCTGGGAGTCACTGCAGCCAGAGCCCTCTCACCCCTACTAGGCTCAGCCCAGGTGGAGGCGAGAT
  GAGCTGGCGCAGCCCCGCCCTCCATCCTCCCCACATCCCTGCAGCCACCTCCCAGCAGAGCAGGCTACGT
  CCTCACTGAGGTGTTCTTCATGAGAGTACTAGCCTCCTCCACTCCTCCCCACAGCGCAGAGGAAACAGGC
  CAGCCCAGTGACATGACGTTATTAGTTTTGTTTTACCTAATGTAATAAATTTTATTGTATAAATATATCA
  CCATTTACATGAGGGGAA
  
  ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
• Restriction Sites: SgfI-MluI
• OTI Disclaimer: Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
• Product Components: The cDNA clone is shipped in a 2-D bar-coded Matrix tube as 10 ug dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.

Reference Data

• RefSeq: NM_000347.5
• Summary: 'This locus encodes a member of the spectrin gene family. Spectrin proteins, along with ankyrin, play a role in cell membrane organization and stability. The protein encoded by this locus functions in stability of erythrocyte membranes, and mutations in this gene have been associated with spherocytosis type 2, hereditary elliptocytosis, and neonatal hemolytic anemia. Alternatively spliced transcript variants have been described. [provided by RefSeq, Nov 2009]'
• Locus ID: 6710