Dystrobrevin alpha (DTNA) (NM_001128175) Human 3' UTR Clone

CAT#: SC203343

3`UTR clone of dystrobrevin alpha (DTNA) transcript variant 9 for miRNA target validation

Specifications

Product Data

• Vector: pMirTarget
• Species: Human
• Transfection Reporter: RFP
• Assay Reporter: Luciferase
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Symbol: DTNA
• Synonyms: D18S892E; DRP3; DTN; DTN-A; LVNC1
• ACCN: NM_001128175
• Insert Size: 255 bp
• Sequence Data:
  Insert Sequence

  >SC203343 3'UTR clone of NM_001128175
  The sequence shown below is from the reference sequence of NM_001128175. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon
  
  
  CAATTGGCAGAGCTCAGAATTCAAGCGATCGC
  
  GTGCTTTTGGTGGATGCGTCTAGATGGATAACATGACTTCTTCTACCCTAAAATATTCCTATAATACTTT
  GAGCTGTTCTGGTTCCTCCAGGGTGCATGGTACCCATTAACCCAAAATATGATTATTTCCCTTTTTTCCC
  ATTTTCAGTCATTTTGGAATGTTCTCTGTGAACCACAGTTGTGTTGTTTAAAGCTCACATTTCTTTCTGT
  CACCACAGAGATTGGCCTACGGTTTCTGTTTTGAGGGTGCTGTTC
  
  ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
• Restriction Sites: SgfI-MluI
• OTI Disclaimer: Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
• Product Components: The cDNA clone is shipped in a 2-D bar-coded Matrix tube as 10 ug dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.

Reference Data

• RefSeq: NM_001128175.1
• Summary: 'The protein encoded by this gene belongs to the dystrobrevin subfamily of the dystrophin family. This protein is a component of the dystrophin-associated protein complex (DPC), which consists of dystrophin and several integral and peripheral membrane proteins, including dystroglycans, sarcoglycans, syntrophins and alpha- and beta-dystrobrevin. The DPC localizes to the sarcolemma and its disruption is associated with various forms of muscular dystrophy. Mutations in this gene are associated with left ventricular noncompaction with congenital heart defects. Multiple alternatively spliced transcript variants encoding different isoforms have been identified for this gene. [provided by RefSeq, Jul 2008]'
• Locus ID: 1837