PRPF3 (NM_004698) Human 3' UTR Clone

CAT#: SC203358

3`UTR clone of PRP3 pre-mRNA processing factor 3 homolog (S. cerevisiae) (PRPF3) for miRNA target validation

Specifications

Product Data

• Vector: pMirTarget
• Species: Human
• Transfection Reporter: RFP
• Assay Reporter: Luciferase
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Symbol: PRPF3
• Synonyms: HPRP3; HPRP3P; PRP3; Prp3p; RP18; SNRNP90
• ACCN: NM_004698
• Insert Size: 275
• Sequence Data:
  Insert Sequence

  >SC203358 3'UTR clone of NM_004698
  The sequence shown below is from the reference sequence of NM_004698. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon
  
  
  CAATTGGCAGAGCTCAGAATTCAAGCGATCGC
  
  ACCTTGCGCTGAGTGAATCTGTGTTAGAGTCCACTGATTGAGACTACTGCAAGCCCTTGCCTCTCCTCCC
  TTGCCTTTGTCTCTTCAGTCCTCTCACTTATTCTATTTCCCAACCCCCTCCCACTTGTTTGTGTGATCTC
  AGAACTGTGCCAAGCAGACACTGGGACAAAGGGAGAATATCTTGCTCCCCTCCTGAGTCAGCCTGGTGTT
  GCCCTTTATTCCCCTTATGTGCATATGATTAAAGAGTTATTTTTAAACTTGGTGTGATATTTTTC
  
  ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
• Restriction Sites: SgfI-MluI
• OTI Disclaimer: Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).

Reference Data

• RefSeq: NM_004698.2
• Summary: The removal of introns from nuclear pre-mRNAs occurs on complexes called spliceosomes, which are made up of 4 small nuclear ribonucleoprotein (snRNP) particles and an undefined number of transiently associated splicing factors. This gene product is one of several proteins that associate with U4 and U6 snRNPs. Mutations in this gene are associated with retinitis pigmentosa-18. [provided by RefSeq, Jul 2008]
• Locus ID: 9129