ASS1 (NM_000050) Human 3' UTR Clone

CAT#: SC203378

3`UTR clone of argininosuccinate synthetase 1 (ASS1) transcript variant 1 for miRNA target validation

Reconstitution Protocol

USD 560.00

4 Weeks*

Size
    • 10 ug

Product Images

Other products for "ASS1"

Specifications

Product Data
Vector pMirTarget
Species Human
Transfection Reporter RFP
Assay Reporter Luciferase
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Symbol ASS1
Synonyms ASS; CTLN1
ACCN NM_000050
Insert Size 274 bp
Sequence Data
>SC203378 3'UTR clone of NM_000050
The sequence shown below is from the reference sequence of NM_000050. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon


CAATTGGCAGAGCTCAGAATTCAAGCGATCGC

TCATCGTCTCCAGAGCAAGGTCACTGCCAAATAGACCCGTGTACAATGAGGAGCTGGGGCCTCCTCAATT
TGCAGATCCCCCAAGTACAGGCGCTAATTGTTGTGATAATTTGTAATTGTGACTTGTTCTCCCCGGCTGG
CAGCGTAGTGGGGCTGCCAGGCCCCAGCTTTGTTCCCTGGTCCCCCTGAAGCCTGCAAACGTTGTCATCG
AAGGGAAGGGTGGGGGGCAGCTGCGGTGGGGAGCTATAAAAATGACAATTAAAAGAGACACTAG

ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as 10 ug dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.
Reference Data
RefSeq NM_000050.4
Summary 'The protein encoded by this gene catalyzes the penultimate step of the arginine biosynthetic pathway. There are approximately 10 to 14 copies of this gene including the pseudogenes scattered across the human genome, among which the one located on chromosome 9 appears to be the only functional gene for argininosuccinate synthetase. Mutations in the chromosome 9 copy of this gene cause citrullinemia. Two transcript variants encoding the same protein have been found for this gene. [provided by RefSeq, Aug 2012]'
Locus ID 445

Documents

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.