MCM5 (NM_006739) Human 3' UTR Clone

CAT#: SC203399

3`UTR clone of minichromosome maintenance complex component 5 (MCM5) for miRNA target validation

Reconstitution Protocol

USD 560.00

4 Weeks*

Size
    • 10 ug

Product Images

Other products for "MCM5"

Specifications

Product Data
Vector pMirTarget
Species Human
Transfection Reporter RFP
Assay Reporter Luciferase
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Symbol MCM5
Synonyms CDC46; MGORS8; P1-CDC46
ACCN NM_006739
Insert Size 265 bp
Sequence Data
>SC203399 3'UTR clone of NM_006739
The sequence shown below is from the reference sequence of NM_006739. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon


CAATTGGCAGAGCTCAGAATTCAAGCGATCGC

GTTCTCTACCGCCTCAAGTGAGTCGCGCCGCCTCACTGGACTCATGGACTCGCCCACGCCTCGCCCCTCC
TGCCGCTGCCTGCCATTGACAATGTTGCTGGGACCTCTGCCTCCCCACTGCAGCCCTCGAACTTCCCAGG
CACCCTCCTTTCTGCCCCAGAGGAAGGAGCTGTAGTGTCCTGCTGCCTCTGGGCGCCCGCCTCTAGCGCG
GTTCTGGGAAGTGTGCTTTTGGCATCCGTTAATAATAAAGCCACGGTGTGTTCAG

ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as 10 ug dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.
Reference Data
RefSeq NM_006739.3
Summary 'The protein encoded by this gene is structurally very similar to the CDC46 protein from S. cerevisiae, a protein involved in the initiation of DNA replication. The encoded protein is a member of the MCM family of chromatin-binding proteins and can interact with at least two other members of this family. The encoded protein is upregulated in the transition from the G0 to G1/S phase of the cell cycle and may actively participate in cell cycle regulation. [provided by RefSeq, Jul 2008]'
Locus ID 4174

Documents

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.