Integrin beta 4 (ITGB4) (NM_000213) Human 3' UTR Clone

CAT#: SC203402

3`UTR clone of integrin beta 4 (ITGB4) transcript variant 1 for miRNA target validation

Specifications

Product Data

• Vector: pMirTarget
• Species: Human
• Transfection Reporter: RFP
• Assay Reporter: Luciferase
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Symbol: ITGB4
• Synonyms: CD104; GP150
• ACCN: NM_000213
• Insert Size: 267
• Sequence Data:
  Insert Sequence

  >SC203402 3'UTR clone of NM_000213
  The sequence shown below is from the reference sequence of NM_000213. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon
  
  
  CAATTGGCAGAGCTCAGAATTCAAGCGATCGC
  
  CATGGACCAACAGTTCTTCCAAACTTGACCGCACCCTGCCCCACCCCCGCCACGTCCCACTAGGCGTCCT
  CCCGACTCCTCTCCCGGAGCCTCCTCAGCTACTCCATCCTTGCACCCCTGGGGGCCCAGCCCACCCGCAT
  GCACAGAGCAGGGGCTAGGTGTCTCCTGGGAGGCATGAAGGGGGCAAGGTCCGTCCTCTGTGGGCCCAAA
  CCTATTTGTAACCAAAGAGCTGGGAGCAGCACAAGGACCCAGCCTTTGTTCTGCACT
  
  ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
• Restriction Sites: SgfI-MluI
• OTI Disclaimer: Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).

Reference Data

• RefSeq: NM_000213.3
• Summary: Integrins are heterodimers comprised of alpha and beta subunits, that are noncovalently associated transmembrane glycoprotein receptors. Different combinations of alpha and beta polypeptides form complexes that vary in their ligand-binding specificities. Integrins mediate cell-matrix or cell-cell adhesion, and transduced signals that regulate gene expression and cell growth. This gene encodes the integrin beta 4 subunit, a receptor for the laminins. This subunit tends to associate with alpha 6 subunit and is likely to play a pivotal role in the biology of invasive carcinoma. Mutations in this gene are associated with epidermolysis bullosa with pyloric atresia. Multiple alternatively spliced transcript variants encoding distinct isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
• Locus ID: 3691