PHPT1 (NM_001135861) Human 3' UTR Clone

CAT#: SC203434

3`UTR clone of phosphohistidine phosphatase 1 (PHPT1) transcript variant 2 for miRNA target validation


Reconstitution Protocol

USD 560.00

4 Weeks*

Size
    • 10 ug

Product Images

Other products for "PHPT1"

Specifications

Product Data
Vector pMirTarget
Species Human
Transfection Reporter RFP
Assay Reporter Luciferase
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Symbol PHPT1
Synonyms CGI-202; HEL-S-132P; HSPC141; PHP; PHP14
ACCN NM_001135861
Insert Size 248
Sequence Data
>SC203434 3'UTR clone of NM_001135861
The sequence shown below is from the reference sequence of NM_001135861. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon


CAATTGGCAGAGCTCAGAATTCAAGCGATCGC

AGCACGCCATTTCAACTGAGAAAATCAAAGCCAAGTACCCCGACTACGAGGTCACCTGGGCTAACGACGG
CTACTGAGCACTCCCAGCCCGGGGCCTGCTGCCTCCAGCAGCCACTTCAGAGCCCCCGCCTTTGCCTGCA
CTCCTCTTGCAGGGCTGGCCCTGCCTGCTCCTGCGGCAGCCTCTGGTGACGTGCTGTCCACCAGGCCTTG
GAGACAGGCTAGCCTGGCCACAGAATTAAACGTGTTGC

ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Reference Data
RefSeq NM_001135861.1
Summary This gene encodes an enzyme that catalyzes the reversible dephosphorylation of histidine residues in proteins. It may be involved in the dephosphorylation of G-beta and ATP citrate lyase and in negatively regulating CD4 T lymphocytes by dephosphorylation and inhibition of KCa3.1 channels. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Dec 2013]
Locus ID 29085

Documents

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.