STAT1 (NM_139266) Human 3' UTR Clone

CAT#: SC203451

3`UTR clone of signal transducer and activator of transcription 1 91kDa (STAT1) transcript variant beta for miRNA target validation

Specifications

Product Data

• Vector: pMirTarget
• Species: Human
• Transfection Reporter: RFP
• Assay Reporter: Luciferase
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Symbol: STAT1
• Synonyms: CANDF7; IMD31A; IMD31B; IMD31C; ISGF-3; STAT91
• ACCN: NM_139266
• Insert Size: 276 bp
• Sequence Data:
  Insert Sequence

  >SC203451 3'UTR clone of NM_139266
  The sequence shown below is from the reference sequence of NM_139266. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon
  
  
  CAATTGGCAGAGCTCAGAATTCAAGCGATCGC
  
  GACTGAGTTGATTTCTGTGTCTGAAGTGTAAGTGAACACAGAAGAGTGACATGTTTACAAACCTCAAGCC
  AGCCTTGCTCCTGGCTGGGGCCTGTTGAAGATGCTTGTATTTTACTTTTCCATTGTAATTGCTATCGCCA
  TCACAGCTGAACTTGTTGAGATCCCCGTGTTACTGCCTATCAGCATTTTACTACTTTAAAAAAAAAAAAA
  AAGCCAAAAACCAAATTTGTATTTAAGGTATATAAATTTTCCCAAAACTGATACCCTTTGAAAAAG
  
  ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
• Restriction Sites: SgfI-MluI
• OTI Disclaimer: Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
• Product Components: The cDNA clone is shipped in a 2-D bar-coded Matrix tube as 10 ug dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.

Reference Data

• RefSeq: NM_139266.2
• Summary: 'The protein encoded by this gene is a member of the STAT protein family. In response to cytokines and growth factors, STAT family members are phosphorylated by the receptor associated kinases, and then form homo- or heterodimers that translocate to the cell nucleus where they act as transcription activators. The protein encoded by this gene can be activated by various ligands including interferon-alpha, interferon-gamma, EGF, PDGF and IL6. This protein mediates the expression of a variety of genes, which is thought to be important for cell viability in response to different cell stimuli and pathogens. The protein plays an important role in immune responses to viral, fungal and mycobacterial pathogens. Mutations in this gene are associated with Immunodeficiency 31B, 31A, and 31C. [provided by RefSeq, Jun 2020]'
• Locus ID: 6772