Spermidine synthase (SRM) (NM_003132) Human 3' UTR Clone

CAT#: SC203480

3`UTR clone of spermidine synthase (SRM) for miRNA target validation

Specifications

Product Data

• Vector: pMirTarget
• Species: Human
• Transfection Reporter: RFP
• Assay Reporter: Luciferase
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Symbol: SRM
• Synonyms: PAPT; SPDSY; SPS1; SRML1
• ACCN: NM_003132
• Insert Size: 282
• Sequence Data:
  Insert Sequence

  >SC203480 3'UTR clone of NM_003132
  The sequence shown below is from the reference sequence of NM_003132. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon
  
  
  CAATTGGCAGAGCTCAGAATTCAAGCGATCGC
  
  CCCTGAATGATGTGAGCTGAGCCCAGGCGCCACCACTGATGCCACCCAGGACCTCGGACCTTGGAGCCTG
  CGGGGTGCCTCGGCCCCTCCAGCCCCGGGCCGGACCTCCTGCTGGCTCTCGCCCACCAACCAAGTGTTAC
  AAGCCCCAGAATGCTGCCCGGCCTGCCCTGCTGGGCGGACTGTCTGTGTGTCTGTCTCTCTGGCGTTCCA
  CCTCCAAGCCTATACCAGCTGTGTACAGCGCCATCTCTCTGCCTTCTGTTGCCCCTCACTCACCAAACAC
  GT
  
  ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
• Restriction Sites: SgfI-MluI
• OTI Disclaimer: Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).

Reference Data

• RefSeq: NM_003132.2
• Summary: The polyamines putrescine, spermine, and spermidine are ubiquitous polycationic mediators of cell growth and differentiation. Spermidine synthase is one of four enzymes in the polyamine-biosynthetic pathway and carries out the final step of spermidine biosynthesis. This enzyme catalyzes the conversion of putrescine to spermidine using decarboxylated S-adenosylmethionine as the cofactor. [provided by RefSeq, Jul 2008]
• Locus ID: 6723