KLRC3 (NM_002261) Human 3' UTR Clone

CAT#: SC203488

3`UTR clone of killer cell lectin-like receptor subfamily C member 3 (KLRC3) transcript variant 1 for miRNA target validation

Specifications

Product Data

• Vector: pMirTarget
• Species: Human
• Transfection Reporter: RFP
• Assay Reporter: Luciferase
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Symbol: KLRC3
• Synonyms: NKG2-E; NKG2E
• ACCN: NM_002261
• Insert Size: 256 bp
• Sequence Data:
  Insert Sequence

  >SC203488 3'UTR clone of NM_002261
  The sequence shown below is from the reference sequence of NM_002261. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon
  
  
  CAATTGGCAGAGCTCAGAATTCAAGCGATCGC
  
  CTGGTCTTGAACTCCTGAGCTCAAGAAATCAACACATCTTGGCCTCCCAAGTTGCTGGGATTACTGACAC
  AAGCCACCGCCCCTGAGTGCTCATGTACCATTTAGCTTGTGTTTTAAAAATCTACTTTTTCTGCCCTCCC
  TATTTTTAACTAGATGATGTTTTAAAAATTACTTTTCCCTCTCTATATAGTTTGATTTAAGCATTAGTCA
  TTTACAACAAATATTAATATTAAAATGCAGACCGTTATGATTGGAA
  
  ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
• Restriction Sites: SgfI-MluI
• OTI Disclaimer: Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
• Product Components: The cDNA clone is shipped in a 2-D bar-coded Matrix tube as 10 ug dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.

Reference Data

• RefSeq: NM_002261.2
• Summary: 'Natural killer (NK) cells are lymphocytes that can mediate lysis of certain tumor cells and virus-infected cells without previous activation. They can also regulate specific humoral and cell-mediated immunity. NK cells preferentially express several calcium-dependent (C-type) lectins, which have been implicated in the regulation of NK cell function. KLRC3 is a member of the NKG2 group which are expressed primarily in natural killer (NK) cells and encodes a family of transmembrane proteins characterized by a type II membrane orientation (extracellular C terminus) and the presence of a C-type lectin domain. The NKG2 gene family is located within the NK complex, a region that contains several C-type lectin genes preferentially expressed on NK cells. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Jul 2008]'
• Locus ID: 3823