C1QA (NM_015991) Human 3' UTR Clone

CAT#: SC203508

3`UTR clone of complement component 1 q subcomponent A chain (C1QA) for miRNA target validation

Specifications

Product Data

• Vector: pMirTarget
• Species: Human
• Transfection Reporter: RFP
• Assay Reporter: Luciferase
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Symbol: C1QA
• Synonyms: complement component 1, q subcomponent, A chain; complement component 1, q subcomponent, alpha polypeptide; complement component C1q, A chain; OTTHUMP00000002936
• ACCN: NM_015991
• Insert Size: 307 bp
• Sequence Data:
  Insert Sequence

  >SC203508 3'UTR clone of NM_015991
  The sequence shown below is from the reference sequence of NM_015991. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon
  
  
  CAATTGGCAGAGCTCAGAATTCAAGCGATCGC
  
  TTCAGCGGCTTCCTCATCTTCCCATCTGCCTGAGCCAGGGAAGGACCCCCTCCCCCACCCACCTCTCTGG
  CTTCCATGCTCCGCCTGTAAAATGGGGGCGCTATTGCTTCAGCTGCTGAAGGGAGGGGGCTGGCTCTGAG
  AGCCCCAGGACTGGCTGCCCCGTGACACATGCTCTAAGAAGCTCGTTTCTTAGACCTCTTCCTGGAATAA
  ACATCTGTGTCTGTGTCTGCTGAACATGAGCTTCAGTTGCTACTCGGAGCATTGAGAGGGAGGCCTAAGA
  ATAATAACAATCCAGTGCTTAAGAGTC
  
  ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
• Restriction Sites: SgfI-MluI
• OTI Disclaimer: Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
• Product Components: The cDNA clone is shipped in a 2-D bar-coded Matrix tube as 10 ug dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.

Reference Data

• RefSeq: NM_015991.2
• Summary: 'This gene encodes the A-chain polypeptide of serum complement subcomponent C1q, which associates with C1r and C1s to yield the first component of the serum complement system. C1q deficiency is associated with lupus erythematosus and glomerulonephritis. C1q is composed of 18 polypeptide chains which include 6 A-chains, 6 B-chains, and 6 C-chains. Each chain contains an N-terminal collagen-like region and a C-terminal C1q globular domain. Alternate splicing results in multiple transcript variants. [provided by RefSeq, Nov 2016]'
• Locus ID: 712