RPS27A (NM_001135592) Human 3' UTR Clone

CAT#: SC203534

3`UTR clone of ribosomal protein S27a (RPS27A) transcript variant 2 for miRNA target validation

Specifications

Product Data

• Vector: pMirTarget
• Species: Human
• Transfection Reporter: RFP
• Assay Reporter: Luciferase
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Symbol: RPS27A
• Synonyms: CEP80; HEL112; S27A; UBA80; UBC; UBCEP1; UBCEP80
• ACCN: NM_001135592
• Insert Size: 293 bp
• Sequence Data:
  Insert Sequence

  >SC203534 3'UTR clone of NM_001135592
  The sequence shown below is from the reference sequence of NM_001135592. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon
  
  
  CAATTGGCAGAGCTCAGAATTCAAGCGATCGC
  
  GCAAATGTTGTCTGACTTACTGTTTCAACAAACCAGAAGACAAGTAACTGTATGAGTTAATAAAAGACAT
  GAACTAACATTTATTGTTGGGTTTTATTGCAGTAAAAAGAATGGTTTTTAAGCACCAAATTGATGGTCAC
  ACCATTTCCTTTTAGTAGTGCTACTGCTATCGCTGTGTGAATGTTGCCTCTGGGGATTATGTGACCCAGT
  GGTTCTGTATACCTGCCAGGTGCCAACCACTTGTAAAGGTCTTGATATTTTCAATTCTTAGACTACCTAT
  ACTTTGGCAGAAG
  
  ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
• Restriction Sites: SgfI-MluI
• OTI Disclaimer: Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
• Product Components: The cDNA clone is shipped in a 2-D bar-coded Matrix tube as 10 ug dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.

Reference Data

• RefSeq: NM_001135592.2
• Summary: 'Ubiquitin, a highly conserved protein that has a major role in targeting cellular proteins for degradation by the 26S proteosome, is synthesized as a precursor protein consisting of either polyubiquitin chains or a single ubiquitin fused to an unrelated protein. This gene encodes a fusion protein consisting of ubiquitin at the N terminus and ribosomal protein S27a at the C terminus. When expressed in yeast, the protein is post-translationally processed, generating free ubiquitin monomer and ribosomal protein S27a. Ribosomal protein S27a is a component of the 40S subunit of the ribosome and belongs to the S27AE family of ribosomal proteins. It contains C4-type zinc finger domains and is located in the cytoplasm. Pseudogenes derived from this gene are present in the genome. As with ribosomal protein S27a, ribosomal protein L40 is also synthesized as a fusion protein with ubiquitin; similarly, ribosomal protein S30 is synthesized as a fusion protein with the ubiquitin-like protein fubi. Multiple alternatively spliced transcript variants that encode the same proteins have been identified.[provided by RefSeq, Sep 2008]'
• Locus ID: 6233