EIF4A3 (NM_014740) Human 3' UTR Clone

CAT#: SC203536

3`UTR clone of eukaryotic translation initiation factor 4A isoform 3 (EIF4A3) for miRNA target validation

Specifications

Product Data

• Vector: pMirTarget
• Species: Human
• Transfection Reporter: RFP
• Assay Reporter: Luciferase
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Symbol: EIF4A3
• Synonyms: DDX48; eIF-4A-III; eIF4A-III; eIF4AIII; Fal1; MUK34; NMP265; NUK34; RCPS
• ACCN: NM_014740
• Insert Size: 299
• Sequence Data:
  Insert Sequence

  >SC203536 3'UTR clone of NM_014740
  The sequence shown below is from the reference sequence of NM_014740. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon
  
  
  CAATTGGCAGAGCTCAGAATTCAAGCGATCGC
  
  ATGCCGATGAACGTTGCTGATCTTATCTGAAGCAGCAGATCAGTGGGATGAGGGAGACTGTTCACCTGCT
  GTGTACTCCTGTTTGGAAGTATTTAGATCCAGATTCTACTTAATGGGGTTTATATGGACTTTCTTCTCAT
  AAATGGCCTGCCGTCTCCCTTCCTTTGAAGAGGATATGGGGATTCTGCTCTCTTTTCTTATTTACATGTA
  AATAATACATTGTTCTAAGTCTTTTTCATTAAAAATTTAAAACTTTTCCCATAAACTCTATACTTCTAAG
  GTGCCACCACCTTCTCTAG
  
  ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
• Restriction Sites: SgfI-MluI
• OTI Disclaimer: Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).

Reference Data

• RefSeq: NM_014740.3
• Summary: This gene encodes a member of the DEAD box protein family. DEAD box proteins, characterized by the conserved motif Asp-Glu-Ala-Asp (DEAD), are putative RNA helicases. They are implicated in a number of cellular processes involving alteration of RNA secondary structure, such as translation initiation, nuclear and mitochondrial splicing, and ribosome and spliceosome assembly. Based on their distribution patterns, some members of this family are believed to be involved in embryogenesis, spermatogenesis, and cellular growth and division. The protein encoded by this gene is a nuclear matrix protein. Its amino acid sequence is highly similar to the amino acid sequences of the translation initiation factors eIF4AI and eIF4AII, two other members of the DEAD box protein family. [provided by RefSeq, Jul 2008]
• Locus ID: 9775