WASP (WAS) (NM_000377) Human 3' UTR Clone

CAT#: SC203562

3`UTR clone of Wiskott-Aldrich syndrome (eczema-thrombocytopenia) (WAS) for miRNA target validation

Specifications

Product Data

• Vector: pMirTarget
• Species: Human
• Transfection Reporter: RFP
• Assay Reporter: Luciferase
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Symbol: WAS
• Synonyms: IMD2; SCNX; THC; THC1; WASP; WASPA
• ACCN: NM_000377
• Insert Size: 304 bp
• Sequence Data:
  Insert Sequence

  >SC203562 3'UTR clone of NM_000377
  The sequence shown below is from the reference sequence of NM_000377. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon
  
  
  CAATTGGCAGAGCTCAGAATTCAAGCGATCGC
  
  GACCAGGCTGGCGATGAAGATGAAGATGATGAATGGGATGACTGAGTGGCTGAGTTACTTGCTGCCCTGT
  GCTCCTCCCCGCAGGACATGGCTCCCCCTCCACCTGCTCTGTGCCCACCCTCCACTCTCCTCTTCCAGGC
  CCCCAACCCCCCATTTCTTCCCCACCAACCCCTCCAATGCTGTTATCCCTGCCTGGTCCTCACACTCACC
  CAACAATCCCAAGGCCCTTTTTATACAAAAATTCTCAGTTCTCTTCACTCAAGGATTTTTAAAGAAAAAT
  AAAAGAATTGTCTTTCTGTCTCTC
  
  ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
• Restriction Sites: SgfI-MluI
• OTI Disclaimer: Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
• Product Components: The cDNA clone is shipped in a 2-D bar-coded Matrix tube as 10 ug dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.

Reference Data

• RefSeq: NM_000377.2
• Summary: ' The Wiskott-Aldrich syndrome (WAS) family of proteins share similar domain structure, and are involved in transduction of signals from receptors on the cell surface to the actin cytoskeleton. The presence of a number of different motifs suggests that they are regulated by a number of different stimuli, and interact with multiple proteins. Recent studies have demonstrated that these proteins, directly or indirectly, associate with the small GTPase, Cdc42, known to regulate formation of actin filaments, and the cytoskeletal organizing complex, Arp2/3. Wiskott-Aldrich syndrome is a rare, inherited, X-linked, recessive disease characterized by immune dysregulation and microthrombocytopenia, and is caused by mutations in the WAS gene. The WAS gene product is a cytoplasmic protein, expressed exclusively in hematopoietic cells, which show signalling and cytoskeletal abnormalities in WAS patients. A transcript variant arising as a result of alternative promoter usage, and containing a different 5' UTR sequence, has been described, however, its full-length nature is not known. [provided by RefSeq, Jul 2008]'
• Locus ID: 7454