APE1 (APEX1) (NM_080649) Human 3' UTR Clone

CAT#: SC203566

3`UTR clone of APEX nuclease (multifunctional DNA repair enzyme) 1 (APEX1) transcript variant 3 for miRNA target validation

Specifications

Product Data

• Vector: pMirTarget
• Species: Human
• Transfection Reporter: RFP
• Assay Reporter: Luciferase
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Symbol: APEX1
• Synonyms: APE; APE1; APEN; APEX; APX; HAP1; REF1
• ACCN: NM_080649
• Insert Size: 273 bp
• Sequence Data:
  Insert Sequence

  >SC203566 3'UTR clone of NM_080649
  The sequence shown below is from the reference sequence of NM_080649. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon
  
  
  CAATTGGCAGAGCTCAGAATTCAAGCGATCGC
  
  CACCCTATACCTAGCACTGTGACACCACCCCTAAATCACTTTGAGCCTGGGAAATAAGCCCCCTCAACTA
  CCATTCCTTCTTTAAACACTCTTCAGAGAAATCTGCATTCTATTTCTCATGTATAAAACTAGGAATCCTC
  CAACCAGGCTCCTGTGATAGAGTTCTTTTAAGCCCAAGATTTTTTATTTGAGGGTTTTTTGTTTTTTAAA
  AAAAAATTGAACAAAGACTACTAATGACTTTGTTTGAATTATCCACATGAAAATAAAGAGCCA
  
  ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
• Restriction Sites: SgfI-MluI
• OTI Disclaimer: Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
• Product Components: The cDNA clone is shipped in a 2-D bar-coded Matrix tube as 10 ug dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.

Reference Data

• RefSeq: NM_080649.1
• Summary: 'The APEX gene encodes the major AP endonuclease in human cells. It encodes the APEX endonuclease, a DNA repair enzyme with apurinic/apyrimidinic (AP) activity. Such AP activity sites occur frequently in DNA molecules by spontaneous hydrolysis, by DNA damaging agents or by DNA glycosylases that remove specific abnormal bases. The AP sites are the most frequent pre-mutagenic lesions that can prevent normal DNA replication. Splice variants have been found for this gene; all encode the same protein. Disruptions in the biological functions related to APEX are associated with many various malignancies and neurodegenerative diseases.[provided by RefSeq, Dec 2019]'
• Locus ID: 328