BLNK (NM_001114094) Human 3' UTR Clone

CAT#: SC203590

3`UTR clone of B-cell linker (BLNK) transcript variant 2 for miRNA target validation

Specifications

Product Data

• Vector: pMirTarget
• Species: Human
• Transfection Reporter: RFP
• Assay Reporter: Luciferase
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Symbol: BLNK
• Synonyms: AGM4; BASH; bca; BLNK-S; LY57; SLP-65; SLP65
• ACCN: NM_001114094
• Insert Size: 281
• Sequence Data:
  Insert Sequence

  >SC203590 3'UTR clone of NM_001114094
  The sequence shown below is from the reference sequence of NM_001114094. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon
  
  
  CAATTGGCAGAGCTCAGAATTCAAGCGATCGC
  
  CCACCAGACTGAAGTATGCAGTTAAAGTTTCATAAAGGGGGAAAAAAAAGATCAATACCATTGCTTCAGA
  CACTTTCCCAAAGTTTCTCCTTTTGAGAAAAAGTCCCAAAACTTCATATTTTGGATTATGAATCATCCAG
  TAATAAAATGGAAGATGGAGTCAGCTATTGAAGTGGTCATCCATTTCTTTTTAAGAAGCTCATGTGGACT
  TGTTCTATTGCCTGACCTGATGAACTGTTAATATCTGGTGAGGTTGAGTTATCATGCTACTAATATTTTC
  C
  
  ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
• Restriction Sites: SgfI-MluI
• OTI Disclaimer: Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).

Reference Data

• RefSeq: NM_001114094.1
• Summary: This gene encodes a cytoplasmic linker or adaptor protein that plays a critical role in B cell development. This protein bridges B cell receptor-associated kinase activation with downstream signaling pathways, thereby affecting various biological functions. The phosphorylation of five tyrosine residues is necessary for this protein to nucleate distinct signaling effectors following B cell receptor activation. Mutations in this gene cause hypoglobulinemia and absent B cells, a disease in which the pro- to pre-B-cell transition is developmentally blocked. Deficiency in this protein has also been shown in some cases of pre-B acute lymphoblastic leukemia. Alternatively spliced transcript variants have been found for this gene. [provided by RefSeq, May 2012]
• Locus ID: 29760