HNRPM (HNRNPM) (NM_005968) Human 3' UTR Clone

CAT#: SC203599

3`UTR clone of heterogeneous nuclear ribonucleoprotein M (HNRNPM) transcript variant 1 for miRNA target validation

Specifications

Product Data

• Vector: pMirTarget
• Species: Human
• Transfection Reporter: RFP
• Assay Reporter: Luciferase
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Symbol: HNRNPM
• Synonyms: CEAR; hnRNP M; HNRNPM4; HNRPM; HNRPM4; HTGR1; NAGR1
• ACCN: NM_005968
• Insert Size: 264 bp
• Sequence Data:
  Insert Sequence

  >SC203599 3'UTR clone of NM_005968
  The sequence shown below is from the reference sequence of NM_005968. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon
  
  
  CAATTGGCAGAGCTCAGAATTCAAGCGATCGC
  
  CCGAGAGATTGACGTTCGAATTGATAGAAACGCTTAAGCAGTTGCCTTTTTTAAACATCGATACGAGACC
  TCTGAATTTGTATTTTTTCTTGTTAACCATTTTAATTTGTTGGCTGGATGTATAAAGATGTTTAAAAAAT
  TCAGTTGCTTTTTGGGGTAATTTGAATTACTTTTTTAATGACTGGGGTTCCATTTGACTGTTTGCATTGA
  GATTGCAATGTGCGCAATTTTTTTTGTAGTTGTGGCATCTTGTTGACATCGAAT
  
  ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
• Restriction Sites: SgfI-MluI
• OTI Disclaimer: Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
• Product Components: The cDNA clone is shipped in a 2-D bar-coded Matrix tube as 10 ug dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.

Reference Data

• RefSeq: NM_005968.3
• Summary: 'This gene belongs to the subfamily of ubiquitously expressed heterogeneous nuclear ribonucleoproteins (hnRNPs). The hnRNPs are RNA binding proteins and they complex with heterogeneous nuclear RNA (hnRNA). These proteins are associated with pre-mRNAs in the nucleus and appear to influence pre-mRNA processing and other aspects of mRNA metabolism and transport. While all of the hnRNPs are present in the nucleus, some seem to shuttle between the nucleus and the cytoplasm. The hnRNP proteins have distinct nucleic acid binding properties. The protein encoded by this gene has three repeats of quasi-RRM domains that bind to RNAs. This protein also constitutes a monomer of the N-acetylglucosamine-specific receptor which is postulated to trigger selective recycling of immature GlcNAc-bearing thyroglobulin molecules. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Aug 2011]'
• Locus ID: 4670