CARS (NM_139273) Human 3' UTR Clone

CAT#: SC203614

3`UTR clone of cysteinyl-tRNA synthetase (CARS) transcript variant 1 for miRNA target validation

Specifications

Product Data

• Vector: pMirTarget
• Species: Human
• Transfection Reporter: RFP
• Assay Reporter: Luciferase
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Symbol: CARS
• Synonyms: CARS1; CYSRS; MGC:11246
• ACCN: NM_139273
• Insert Size: 259 bp
• Sequence Data:
  Insert Sequence

  >SC203614 3'UTR clone of NM_139273
  The sequence shown below is from the reference sequence of NM_139273. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon
  
  
  CAATTGGCAGAGCTCAGAATTCAAGCGATCGC
  
  TCAGCAAAGGGCAAGCCAAGAAGCTGAAGAAGCTCTTCGAGGCTCAGGAGAAGCTCTACAAGGAATATCT
  GCAGATGGCCCAGAATGGAAGCTTCCAGTGAGGGGGCACAGGACTGACTTTTTAAACCATTGTGGACTAG
  TGGCTGCTGTCTGCCTCAGTGACAATGTCCCAGCGCTCCTATCATGTTTACAGTCACCCTTGGGTCCTAA
  ATTAAGAGTTGTGTTCATGTAGGTTCGTGTCGTCGTTGGCTCTGAGACA
  
  ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
• Restriction Sites: SgfI-MluI
• OTI Disclaimer: Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
• Product Components: The cDNA clone is shipped in a 2-D bar-coded Matrix tube as 10 ug dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.

Reference Data

• RefSeq: NM_139273.2
• Summary: 'This gene encodes a class 1 aminoacyl-tRNA synthetase, cysteinyl-tRNA synthetase. Each of the twenty aminoacyl-tRNA synthetases catalyzes the aminoacylation of a specific tRNA or tRNA isoaccepting family with the cognate amino acid. This gene is one of several located near the imprinted gene domain on chromosome 11p15.5, an important tumor-suppressor gene region. Alterations in this region have been associated with Beckwith-Wiedemann syndrome, Wilms tumor, rhabdomyosarcoma, adrenocortical carcinoma, and lung, ovarian and breast cancers. Alternative splicing of this gene results in multiple transcript variants. [provided by RefSeq, Aug 2010]'
• Locus ID: 833