THBS3 (NM_007112) Human 3' UTR Clone

CAT#: SC203624

3`UTR clone of thrombospondin 3 (THBS3) for miRNA target validation

Specifications

Product Data

• Vector: pMirTarget
• Species: Human
• Transfection Reporter: RFP
• Assay Reporter: Luciferase
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Symbol: THBS3
• Synonyms: TSP3
• ACCN: NM_007112
• Insert Size: 271 bp
• Sequence Data:
  Insert Sequence

  >SC203624 3'UTR clone of NM_007112
  The sequence shown below is from the reference sequence of NM_007112. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon
  
  
  CAATTGGCAGAGCTCAGAATTCAAGCGATCGC
  
  AGGACTTTGAGCCATTCCGGAGGCAGCTGCTCCAGGGAAGGGTGTGAGGAGGAGGCCACCAGATTCAGAA
  TTCAGAATTTTAGACCCTTTGGCCTTGGGGTCCATCCTGGAGACCCTGAGGTCTAAGCTACAGCCCCTCA
  GCCAACCACAGACCCTTCTCTGGCTCCCAAAAGGAGTTCAGTCCCAGAGGGGTGGTCACCCCACCCTTCA
  GGGGATGAGAAGTTTTCAAGGGGTATTACTCAGGCACTAACCCCAGGAAAGATGACAGCAC
  
  ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
• Restriction Sites: SgfI-MluI
• OTI Disclaimer: Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
• Product Components: The cDNA clone is shipped in a 2-D bar-coded Matrix tube as 10 ug dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.

Reference Data

• RefSeq: NM_007112.3
• Summary: 'The protein encoded by this gene belongs to the thrombospondin family. Thrombospondin family members are adhesive glycoproteins that mediate cell-to-cell and cell-to-matrix interactions. This protein forms a pentameric molecule linked by a single disulfide bond. This gene shares a common promoter with metaxin 1. Alternate splicing results in coding and non-coding transcript variants. [provided by RefSeq, Nov 2011]'
• Locus ID: 7059