ADH1C (NM_000669) Human 3' UTR Clone

CAT#: SC203665

3`UTR clone of alcohol dehydrogenase 1C (class I) gamma polypeptide (ADH1C) for miRNA target validation

Specifications

Product Data

• Vector: pMirTarget
• Species: Human
• Transfection Reporter: RFP
• Assay Reporter: Luciferase
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Symbol: ADH1C
• Synonyms: ADH3
• ACCN: NM_000669
• Insert Size: 288
• Sequence Data:
  Insert Sequence

  >SC203665 3'UTR clone of NM_000669
  The sequence shown below is from the reference sequence of NM_000669. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon
  
  
  CAATTGGCAGAGCTCAGAATTCAAGCGATCGC
  
  GCTCTGGAAAGAGTATCCGTACCGTCCTGACGTTTTGAAACAATACAGATGCCTTCCCTTGTAGCAGTTT
  TCAGCCTCCTCTACCCTACATGATCTGGAGCAACAGCTAGGAAATATCATTAATTCTGCTCTTCAGAGAT
  GTTAAAAATAAATTACACGTGGGAGCTTTCCAAAGAAATGGAAATTGATGGGAAATTATTTGTCAAGCAA
  ATGTTTAAAATCCAAATGAGAACTAAATAAAGTGTTGAACATCAACTGGGGAATTGAAGCCAATAAACCT
  TCCTTCTT
  
  ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
• Restriction Sites: SgfI-MluI
• OTI Disclaimer: Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).

Reference Data

• RefSeq: NM_000669.3
• Summary: This gene encodes class I alcohol dehydrogenase, gamma subunit, which is a member of the alcohol dehydrogenase family. Members of this enzyme family metabolize a wide variety of substrates, including ethanol, retinol, other aliphatic alcohols, hydroxysteroids, and lipid peroxidation products. Class I alcohol dehydrogenase, consisting of several homo- and heterodimers of alpha, beta, and gamma subunits, exhibits high activity for ethanol oxidation and plays a major role in ethanol catabolism. Three genes encoding alpha, beta and gamma subunits are tandemly organized in a genomic segment as a gene cluster. [provided by RefSeq, Jul 2008]
• Locus ID: 126