ADH1C (NM_000669) Human 3' UTR Clone

CAT#: SC203665

3`UTR clone of alcohol dehydrogenase 1C (class I) gamma polypeptide (ADH1C) for miRNA target validation


Reconstitution Protocol

USD 560.00

4 Weeks*

Size
    • 10 ug

Product Images

Other products for "ADH1C"

Specifications

Product Data
Vector pMirTarget
Species Human
Transfection Reporter RFP
Assay Reporter Luciferase
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Symbol ADH1C
Synonyms ADH3
ACCN NM_000669
Insert Size 288
Sequence Data
>SC203665 3'UTR clone of NM_000669
The sequence shown below is from the reference sequence of NM_000669. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon


CAATTGGCAGAGCTCAGAATTCAAGCGATCGC

GCTCTGGAAAGAGTATCCGTACCGTCCTGACGTTTTGAAACAATACAGATGCCTTCCCTTGTAGCAGTTT
TCAGCCTCCTCTACCCTACATGATCTGGAGCAACAGCTAGGAAATATCATTAATTCTGCTCTTCAGAGAT
GTTAAAAATAAATTACACGTGGGAGCTTTCCAAAGAAATGGAAATTGATGGGAAATTATTTGTCAAGCAA
ATGTTTAAAATCCAAATGAGAACTAAATAAAGTGTTGAACATCAACTGGGGAATTGAAGCCAATAAACCT
TCCTTCTT

ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Reference Data
RefSeq NM_000669.3
Summary This gene encodes class I alcohol dehydrogenase, gamma subunit, which is a member of the alcohol dehydrogenase family. Members of this enzyme family metabolize a wide variety of substrates, including ethanol, retinol, other aliphatic alcohols, hydroxysteroids, and lipid peroxidation products. Class I alcohol dehydrogenase, consisting of several homo- and heterodimers of alpha, beta, and gamma subunits, exhibits high activity for ethanol oxidation and plays a major role in ethanol catabolism. Three genes encoding alpha, beta and gamma subunits are tandemly organized in a genomic segment as a gene cluster. [provided by RefSeq, Jul 2008]
Locus ID 126

Documents

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.