B3GALT4 (NM_003782) Human 3' UTR Clone

CAT#: SC203697

3`UTR clone of UDP-Gal:betaGlcNAc beta 13-galactosyltransferase polypeptide 4 (B3GALT4) for miRNA target validation

Specifications

Product Data

• Vector: pMirTarget
• Species: Human
• Transfection Reporter: RFP
• Assay Reporter: Luciferase
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Symbol: B3GALT4
• Synonyms: BETA3GALT4; GALT2; GALT4
• ACCN: NM_003782
• Insert Size: 278
• Sequence Data:
  Insert Sequence

  >SC203697 3'UTR clone of NM_003782
  The sequence shown below is from the reference sequence of NM_003782. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon
  
  
  CAATTGGCAGAGCTCAGAATTCAAGCGATCGC
  
  GAGCAATAGCCTGGCTTCAGAGCTGAGAGTGCCTGGGGCCACAGGAAAGGCAGGAACAGGACCTTCTCTC
  TCCCAGGCCCAACGCAGGGGCCCTCACTGGCTGCAGCTGATCTGTTTCCTTATACCAGATCCTCAGTCTC
  ACTAAAGACAGCGATATGGGAGACACCCAGGGGCCTGGCCCGCCAGCCCAAAAGATGGTCATCGGGAAGA
  GAAAAAGAAAAAAATGCTGCAGTTGTTCTCTCAAGCTAGGGCAGAAGAGGGGTGTCAAGCTCCTCAAT
  
  ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
• Restriction Sites: SgfI-MluI
• OTI Disclaimer: Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).

Reference Data

• RefSeq: NM_003782.3
• Summary: This gene is a member of the beta-1,3-galactosyltransferase (beta3GalT) gene family. This family encodes type II membrane-bound glycoproteins with diverse enzymatic functions using different donor substrates (UDP-galactose and UDP-N-acetylglucosamine) and different acceptor sugars (N-acetylglucosamine, galactose, N-acetylgalactosamine). The beta3GalT genes are distantly related to the Drosophila Brainiac gene and have the protein coding sequence contained in a single exon. The beta3GalT proteins also contain conserved sequences not found in the beta4GalT or alpha3GalT proteins. The carbohydrate chains synthesized by these enzymes are designated as type 1, whereas beta4GalT enzymes synthesize type 2 carbohydrate chains. The ratio of type 1:type 2 chains changes during embryogenesis. By sequence similarity, the beta3GalT genes fall into at least two groups: beta3GalT4 and 4 other beta3GalT genes (beta3GalT1-3, beta3GalT5). This gene is oriented telomere to centromere in close proximity to the ribosomal protein S18 gene. The functionality of the encoded protein is limited to ganglioseries glycolipid biosynthesis. [provided by RefSeq, Jul 2008]
• Locus ID: 8705